\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010564258:

Variant ID: vg1010564258 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10564258
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


AATATCAGCATCCTAGTCAAGGTATTCTACTTAATCAGTTTGTATCGTTGCGAAGGCATAACATCCCTCTATATATATAGTCCGCAAAATTTGTTACAGG[A/T]
CATCCAAAAAAGTGTAATTAACTAGGGACACCGCAAAAACGCGTTTATGCTATAGTATACTGTAAAAAGGTGGTAATTAGCTGTTAGACACCCATGGGAC

Reverse complement sequence

GTCCCATGGGTGTCTAACAGCTAATTACCACCTTTTTACAGTATACTATAGCATAAACGCGTTTTTGCGGTGTCCCTAGTTAATTACACTTTTTTGGATG[T/A]
CCTGTAACAAATTTTGCGGACTATATATATAGAGGGATGTTATGCCTTCGCAACGATACAAACTGATTAAGTAGAATACCTTGACTAGGATGCTGATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 19.60% 0.17% 0.15% NA
All Indica  2759 79.50% 20.00% 0.25% 0.18% NA
All Japonica  1512 98.80% 1.10% 0.07% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 95.80% 3.90% 0.34% 0.00% NA
Indica II  465 87.70% 11.40% 0.22% 0.65% NA
Indica III  913 68.10% 31.20% 0.44% 0.22% NA
Indica Intermediate  786 75.60% 24.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010564258 A -> T LOC_Os10g20830.1 upstream_gene_variant ; 417.0bp to feature; MODIFIER silent_mutation Average:52.883; most accessible tissue: Callus, score: 79.746 N N N N
vg1010564258 A -> T LOC_Os10g20820.1 downstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:52.883; most accessible tissue: Callus, score: 79.746 N N N N
vg1010564258 A -> T LOC_Os10g20840.1 downstream_gene_variant ; 2160.0bp to feature; MODIFIER silent_mutation Average:52.883; most accessible tissue: Callus, score: 79.746 N N N N
vg1010564258 A -> T LOC_Os10g20830-LOC_Os10g20840 intergenic_region ; MODIFIER silent_mutation Average:52.883; most accessible tissue: Callus, score: 79.746 N N N N
vg1010564258 A -> DEL N N silent_mutation Average:52.883; most accessible tissue: Callus, score: 79.746 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010564258 6.51E-08 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 8.86E-07 1.02E-16 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 6.80E-06 8.53E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 1.38E-07 NA mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 1.25E-06 3.77E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 6.28E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 5.38E-06 NA mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 6.47E-07 3.50E-10 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.07E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.80E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 7.67E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 4.14E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.24E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 6.38E-21 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 5.33E-12 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.15E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.74E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.45E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 1.32E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010564258 NA 4.02E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251