\
| Variant ID: vg1010548109 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10548109 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTAAAAGGGGGCCCATAAATTGGACAAGATGTTAGAGGACCACAGATCGTCGTTGTACCCAGGTTGCGAGCAGGGGCACAAAAAGTTGGATACCACTCT[A/G]
GAGTTCTTGTAATGGAAGGCAAAAAATGGTATTAGTGACAAGGAATTTGGCGATTTATTGAAACTCATCAAGAACATTCTTCCGGAGGGAAACAAGTTGC
GCAACTTGTTTCCCTCCGGAAGAATGTTCTTGATGAGTTTCAATAAATCGCCAAATTCCTTGTCACTAATACCATTTTTTGCCTTCCATTACAAGAACTC[T/C]
AGAGTGGTATCCAACTTTTTGTGCCCCTGCTCGCAACCTGGGTACAACGACGATCTGTGGTCCTCTAACATCTTGTCCAATTTATGGGCCCCCTTTTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.00% | 2.00% | 1.25% | 76.70% | NA |
| All Indica | 2759 | 2.20% | 0.60% | 0.62% | 96.52% | NA |
| All Japonica | 1512 | 55.00% | 5.00% | 2.71% | 37.24% | NA |
| Aus | 269 | 1.10% | 0.00% | 0.00% | 98.88% | NA |
| Indica I | 595 | 3.70% | 0.00% | 0.84% | 95.46% | NA |
| Indica II | 465 | 1.30% | 1.30% | 0.65% | 96.77% | NA |
| Indica III | 913 | 1.60% | 0.70% | 0.33% | 97.37% | NA |
| Indica Intermediate | 786 | 2.40% | 0.60% | 0.76% | 96.18% | NA |
| Temperate Japonica | 767 | 63.10% | 9.50% | 4.30% | 23.08% | NA |
| Tropical Japonica | 504 | 47.00% | 0.20% | 0.99% | 51.79% | NA |
| Japonica Intermediate | 241 | 46.10% | 0.80% | 1.24% | 51.87% | NA |
| VI/Aromatic | 96 | 17.70% | 1.00% | 0.00% | 81.25% | NA |
| Intermediate | 90 | 36.70% | 1.10% | 1.11% | 61.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010548109 | A -> G | LOC_Os10g20780.1 | upstream_gene_variant ; 4949.0bp to feature; MODIFIER | silent_mutation | Average:9.752; most accessible tissue: Callus, score: 25.173 | N | N | N | N |
| vg1010548109 | A -> G | LOC_Os10g20794.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.752; most accessible tissue: Callus, score: 25.173 | N | N | N | N |
| vg1010548109 | A -> DEL | N | N | silent_mutation | Average:9.752; most accessible tissue: Callus, score: 25.173 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010548109 | NA | 1.07E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010548109 | NA | 1.61E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010548109 | NA | 8.98E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010548109 | NA | 3.47E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010548109 | NA | 9.13E-06 | mr1444_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010548109 | 1.59E-06 | 2.12E-09 | mr1768_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |