\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010540526:

Variant ID: vg1010540526 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10540526
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACACAGTGCCACTATTGTTTCTCTGATTTGAGCTAGATTTATTGGCTTTTCTTAATTAGCTTTGTTTCCACGTTTAGAGCCTAAGTACGAGGAAGCT[T/C]
CGGACGCCGCTTTCGAGGGAGAAGACCCGCACCCTGTGCAAGGCAAGCCTCTTTGATCACATTACCCCTATATTTTCAATGATACATTGTTTGCAAAAAT

Reverse complement sequence

ATTTTTGCAAACAATGTATCATTGAAAATATAGGGGTAATGTGATCAAAGAGGCTTGCCTTGCACAGGGTGCGGGTCTTCTCCCTCGAAAGCGGCGTCCG[A/G]
AGCTTCCTCGTACTTAGGCTCTAAACGTGGAAACAAAGCTAATTAAGAAAAGCCAATAAATCTAGCTCAAATCAGAGAAACAATAGTGGCACTGTGTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 1.20% 4.08% 63.31% NA
All Indica  2759 6.20% 2.00% 5.29% 86.48% NA
All Japonica  1512 65.70% 0.00% 0.86% 33.47% NA
Aus  269 72.90% 0.00% 6.69% 20.45% NA
Indica I  595 6.70% 1.50% 5.04% 86.72% NA
Indica II  465 4.90% 1.50% 2.58% 90.97% NA
Indica III  913 5.30% 2.80% 6.24% 85.65% NA
Indica Intermediate  786 7.60% 1.80% 5.98% 84.61% NA
Temperate Japonica  767 80.30% 0.00% 0.65% 19.04% NA
Tropical Japonica  504 49.40% 0.00% 0.99% 49.60% NA
Japonica Intermediate  241 53.10% 0.00% 1.24% 45.64% NA
VI/Aromatic  96 84.40% 0.00% 9.38% 6.25% NA
Intermediate  90 48.90% 0.00% 7.78% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010540526 T -> C LOC_Os10g20780.1 downstream_gene_variant ; 1582.0bp to feature; MODIFIER silent_mutation Average:17.14; most accessible tissue: Callus, score: 94.247 N N N N
vg1010540526 T -> C LOC_Os10g20770-LOC_Os10g20780 intergenic_region ; MODIFIER silent_mutation Average:17.14; most accessible tissue: Callus, score: 94.247 N N N N
vg1010540526 T -> DEL N N silent_mutation Average:17.14; most accessible tissue: Callus, score: 94.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010540526 NA 8.15E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010540526 NA 1.31E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010540526 NA 1.17E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010540526 NA 1.23E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010540526 NA 5.52E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010540526 NA 2.29E-09 mr1690 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251