\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010479547:

Variant ID: vg1010479547 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10479547
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTACATCGTAAATATACTAAAATTACATATGTAATTATAGTGTAAATACGATGTAATTCAGACAAACCCTCTCTCCGGCGCGGATTTCAAAATTTCAAC[A/G]
GTAAAAGTGGGCCCTACATAAACTCTCATGGACACAACATACAGTGGGTCCCACAAAGAGAAAAAAAGGTCCAACATAACCGTGAAAGCCCAAGGCCCAC

Reverse complement sequence

GTGGGCCTTGGGCTTTCACGGTTATGTTGGACCTTTTTTTCTCTTTGTGGGACCCACTGTATGTTGTGTCCATGAGAGTTTATGTAGGGCCCACTTTTAC[T/C]
GTTGAAATTTTGAAATCCGCGCCGGAGAGAGGGTTTGTCTGAATTACATCGTATTTACACTATAATTACATATGTAATTTTAGTATATTTACGATGTAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.10% 0.50% 0.47% 0.00% NA
All Indica  2759 98.40% 0.80% 0.80% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.00% 2.90% 2.18% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 0.40% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010479547 A -> G LOC_Os10g20700.1 upstream_gene_variant ; 4862.0bp to feature; MODIFIER N Average:82.632; most accessible tissue: Minghui63 young leaf, score: 96.175 N N N N
vg1010479547 A -> G LOC_Os10g20710.1 downstream_gene_variant ; 2488.0bp to feature; MODIFIER N Average:82.632; most accessible tissue: Minghui63 young leaf, score: 96.175 N N N N
vg1010479547 A -> G LOC_Os10g20700-LOC_Os10g20710 intergenic_region ; MODIFIER N Average:82.632; most accessible tissue: Minghui63 young leaf, score: 96.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1010479547 A G -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010479547 NA 8.83E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 NA 1.97E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 6.40E-06 7.91E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 NA 2.53E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 1.07E-06 4.62E-10 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 1.55E-06 2.66E-09 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 5.85E-06 1.40E-08 mr1147_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 8.79E-06 1.79E-08 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010479547 2.40E-06 2.40E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251