Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010454306:

Variant ID: vg1010454306 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10454306
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATTCGGCCGCGTCTTTCCTTCTCCGGTGAAATCTTTAGAGGGGAAATGATCTTCTCGATCTCCTCTTCCTTTTCTCTTTTGGAATCATCGCCTAATT[A/C]
GGTTTGGAAACTCGTGGATTCGAGTTCGATTCGGATCGGCCTCTTTCCTCCGAACCCCGACCTTTCCTTCTCGCCGCCGGCAGCCATGGGCCTTCGCCGC

Reverse complement sequence

GCGGCGAAGGCCCATGGCTGCCGGCGGCGAGAAGGAAAGGTCGGGGTTCGGAGGAAAGAGGCCGATCCGAATCGAACTCGAATCCACGAGTTTCCAAACC[T/G]
AATTAGGCGATGATTCCAAAAGAGAAAAGGAAGAGGAGATCGAGAAGATCATTTCCCCTCTAAAGATTTCACCGGAGAAGGAAAGACGCGGCCGAATTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 18.00% 12.06% 37.60% NA
All Indica  2759 34.90% 1.00% 15.80% 48.24% NA
All Japonica  1512 13.60% 52.20% 7.01% 27.18% NA
Aus  269 97.00% 0.40% 0.74% 1.86% NA
Indica I  595 20.20% 0.30% 9.75% 69.75% NA
Indica II  465 18.90% 0.60% 16.99% 63.44% NA
Indica III  913 53.50% 1.80% 20.26% 24.53% NA
Indica Intermediate  786 34.10% 0.90% 14.50% 50.51% NA
Temperate Japonica  767 12.90% 68.70% 7.56% 10.82% NA
Tropical Japonica  504 8.70% 33.10% 8.53% 49.60% NA
Japonica Intermediate  241 26.10% 39.40% 2.07% 32.37% NA
VI/Aromatic  96 74.00% 9.40% 12.50% 4.17% NA
Intermediate  90 30.00% 25.60% 15.56% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010454306 A -> C LOC_Os10g20680.1 upstream_gene_variant ; 4480.0bp to feature; MODIFIER silent_mutation Average:77.13; most accessible tissue: Zhenshan97 flag leaf, score: 92.878 N N N N
vg1010454306 A -> C LOC_Os10g20670.1 downstream_gene_variant ; 2577.0bp to feature; MODIFIER silent_mutation Average:77.13; most accessible tissue: Zhenshan97 flag leaf, score: 92.878 N N N N
vg1010454306 A -> C LOC_Os10g20670-LOC_Os10g20680 intergenic_region ; MODIFIER silent_mutation Average:77.13; most accessible tissue: Zhenshan97 flag leaf, score: 92.878 N N N N
vg1010454306 A -> DEL N N silent_mutation Average:77.13; most accessible tissue: Zhenshan97 flag leaf, score: 92.878 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1010454306 A C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010454306 4.55E-06 1.27E-06 mr1712_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010454306 3.85E-06 4.65E-07 mr1977_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251