Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010362484:

Variant ID: vg1010362484 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10362484
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGTTACATCCGATTCTCCCCCGCTTCACCGGGTTCGGCAATATTAAAACCTCCAAATTCAGCTTGCAAGATTGTGTTTTCGAGAAGAGAAGTTTTT[C/G]
AGTAAAGCTTTGGAAAATTCCACAGGTCACATATTTCATCCGTTTGAGTTTAGTTTTTCTATGGTTGGTTCCTGTGACTTCCTAAGTGTGAAAAAAATAT

Reverse complement sequence

ATATTTTTTTCACACTTAGGAAGTCACAGGAACCAACCATAGAAAAACTAAACTCAAACGGATGAAATATGTGACCTGTGGAATTTTCCAAAGCTTTACT[G/C]
AAAAACTTCTCTTCTCGAAAACACAATCTTGCAAGCTGAATTTGGAGGTTTTAATATTGCCGAACCCGGTGAAGCGGGGGAGAATCGGATGTAACTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	38.00%	0.85%	0.38%	NA
All Indica	2759	34.40%	63.60%	1.38%	0.62%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	21.50%	76.10%	1.51%	0.84%	NA
Indica II	465	28.20%	68.80%	1.72%	1.29%	NA
Indica III	913	46.90%	51.60%	1.10%	0.44%	NA
Indica Intermediate	786	33.30%	65.00%	1.40%	0.25%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010362484	C -> G	LOC_Os10g20550.1	downstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Callus, score: 48.947	N	N	N	N
vg1010362484	C -> G	LOC_Os10g20560.1	downstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Callus, score: 48.947	N	N	N	N
vg1010362484	C -> G	LOC_Os10g20570.1	downstream_gene_variant ; 4005.0bp to feature; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Callus, score: 48.947	N	N	N	N
vg1010362484	C -> G	LOC_Os10g20560-LOC_Os10g20570	intergenic_region ; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Callus, score: 48.947	N	N	N	N
vg1010362484	C -> DEL	N	N	silent_mutation	Average:33.277; most accessible tissue: Callus, score: 48.947	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010362484	NA	3.94E-41	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	9.86E-12	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	8.08E-11	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	9.47E-40	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	6.95E-11	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	1.88E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	8.98E-16	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	5.55E-14	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	3.84E-16	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	7.00E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	1.37E-19	mr1807	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	5.23E-08	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	2.14E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	3.24E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	4.11E-14	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	6.43E-44	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	1.32E-14	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	2.11E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	1.81E-17	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	5.68E-08	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484	NA	1.36E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251