\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010362484:

Variant ID: vg1010362484 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10362484
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGTTACATCCGATTCTCCCCCGCTTCACCGGGTTCGGCAATATTAAAACCTCCAAATTCAGCTTGCAAGATTGTGTTTTCGAGAAGAGAAGTTTTT[C/G]
AGTAAAGCTTTGGAAAATTCCACAGGTCACATATTTCATCCGTTTGAGTTTAGTTTTTCTATGGTTGGTTCCTGTGACTTCCTAAGTGTGAAAAAAATAT

Reverse complement sequence

ATATTTTTTTCACACTTAGGAAGTCACAGGAACCAACCATAGAAAAACTAAACTCAAACGGATGAAATATGTGACCTGTGGAATTTTCCAAAGCTTTACT[G/C]
AAAAACTTCTCTTCTCGAAAACACAATCTTGCAAGCTGAATTTGGAGGTTTTAATATTGCCGAACCCGGTGAAGCGGGGGAGAATCGGATGTAACTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 38.00% 0.85% 0.38% NA
All Indica  2759 34.40% 63.60% 1.38% 0.62% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 21.50% 76.10% 1.51% 0.84% NA
Indica II  465 28.20% 68.80% 1.72% 1.29% NA
Indica III  913 46.90% 51.60% 1.10% 0.44% NA
Indica Intermediate  786 33.30% 65.00% 1.40% 0.25% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010362484 C -> G LOC_Os10g20550.1 downstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:33.277; most accessible tissue: Callus, score: 48.947 N N N N
vg1010362484 C -> G LOC_Os10g20560.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:33.277; most accessible tissue: Callus, score: 48.947 N N N N
vg1010362484 C -> G LOC_Os10g20570.1 downstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:33.277; most accessible tissue: Callus, score: 48.947 N N N N
vg1010362484 C -> G LOC_Os10g20560-LOC_Os10g20570 intergenic_region ; MODIFIER silent_mutation Average:33.277; most accessible tissue: Callus, score: 48.947 N N N N
vg1010362484 C -> DEL N N silent_mutation Average:33.277; most accessible tissue: Callus, score: 48.947 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010362484 NA 3.94E-41 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 9.86E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 8.08E-11 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 9.47E-40 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 6.95E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 1.88E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 8.98E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 5.55E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 3.84E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 7.00E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 1.37E-19 mr1807 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 5.23E-08 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 2.14E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 3.24E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 4.11E-14 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 6.43E-44 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 1.32E-14 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 2.11E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 1.81E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 5.68E-08 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010362484 NA 1.36E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251