\
| Variant ID: vg1010359560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10359560 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACAAAATATTTTGCTCCTCATAACCAGTCTATCAATTAGCACTGATTCGCTCTTTGTTGCTTGTTTTCCTACCTAGTAAAATAAAGTGCAGGAAAATAT[C/T]
CACTGTTGTGTCTTGGATGAAAGGTCTTCAGGTATTAATTAGCTCCCCCATCAGTGCTTGTTTTACCAAGGAAATCATTGATTATTTAGTCATCACTACC
GGTAGTGATGACTAAATAATCAATGATTTCCTTGGTAAAACAAGCACTGATGGGGGAGCTAATTAATACCTGAAGACCTTTCATCCAAGACACAACAGTG[G/A]
ATATTTTCCTGCACTTTATTTTACTAGGTAGGAAAACAAGCAACAAAGAGCGAATCAGTGCTAATTGATAGACTGGTTATGAGGAGCAAAATATTTTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.20% | 26.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010359560 | C -> T | LOC_Os10g20560.1 | upstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:38.103; most accessible tissue: Callus, score: 67.13 | N | N | N | N |
| vg1010359560 | C -> T | LOC_Os10g20540.1 | downstream_gene_variant ; 4839.0bp to feature; MODIFIER | silent_mutation | Average:38.103; most accessible tissue: Callus, score: 67.13 | N | N | N | N |
| vg1010359560 | C -> T | LOC_Os10g20550.1 | downstream_gene_variant ; 1028.0bp to feature; MODIFIER | silent_mutation | Average:38.103; most accessible tissue: Callus, score: 67.13 | N | N | N | N |
| vg1010359560 | C -> T | LOC_Os10g20550-LOC_Os10g20560 | intergenic_region ; MODIFIER | silent_mutation | Average:38.103; most accessible tissue: Callus, score: 67.13 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010359560 | 3.14E-06 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010359560 | 9.11E-06 | 2.58E-07 | mr1320_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010359560 | 1.48E-07 | 1.48E-07 | mr1320_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |