\
| Variant ID: vg1010358910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10358910 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 103. )
CAAGCTATATAACTTTCCACAGTTTTTCATGGAAAAACTATAGTATAACTATCATGTAAGTACATTATAATTATAATTATTATGTAGTTGTAACCAGTAT[A/G]
TAACTTATATGTATAAAATCATAACGACATTAATAGCTCAGCGGTGAATGCACGCGAGTAGGAAACATTCTATTATTCGCACACCCCTCATTTGCACGAA
TTCGTGCAAATGAGGGGTGTGCGAATAATAGAATGTTTCCTACTCGCGTGCATTCACCGCTGAGCTATTAATGTCGTTATGATTTTATACATATAAGTTA[T/C]
ATACTGGTTACAACTACATAATAATTATAATTATAATGTACTTACATGATAGTTATACTATAGTTTTTCCATGAAAAACTGTGGAAAGTTATATAGCTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 46.30% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 35.40% | 63.60% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 94.70% | 5.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.30% | 79.80% | 0.84% | 0.00% | NA |
| Indica II | 465 | 49.00% | 50.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 44.60% | 54.30% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 29.00% | 69.80% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010358910 | A -> G | LOC_Os10g20560.1 | upstream_gene_variant ; 1193.0bp to feature; MODIFIER | silent_mutation | Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010358910 | A -> G | LOC_Os10g20540.1 | downstream_gene_variant ; 4189.0bp to feature; MODIFIER | silent_mutation | Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010358910 | A -> G | LOC_Os10g20550.1 | downstream_gene_variant ; 378.0bp to feature; MODIFIER | silent_mutation | Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010358910 | A -> G | LOC_Os10g20550-LOC_Os10g20560 | intergenic_region ; MODIFIER | silent_mutation | Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010358910 | 5.58E-09 | 5.58E-09 | mr1024 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 7.65E-07 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 4.86E-11 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 5.51E-23 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 7.44E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 7.93E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 2.43E-07 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 1.72E-11 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010358910 | NA | 4.91E-13 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |