Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010358910:

Variant ID: vg1010358910 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10358910
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGCTATATAACTTTCCACAGTTTTTCATGGAAAAACTATAGTATAACTATCATGTAAGTACATTATAATTATAATTATTATGTAGTTGTAACCAGTAT[A/G]
TAACTTATATGTATAAAATCATAACGACATTAATAGCTCAGCGGTGAATGCACGCGAGTAGGAAACATTCTATTATTCGCACACCCCTCATTTGCACGAA

Reverse complement sequence

TTCGTGCAAATGAGGGGTGTGCGAATAATAGAATGTTTCCTACTCGCGTGCATTCACCGCTGAGCTATTAATGTCGTTATGATTTTATACATATAAGTTA[T/C]
ATACTGGTTACAACTACATAATAATTATAATTATAATGTACTTACATGATAGTTATACTATAGTTTTTCCATGAAAAACTGTGGAAAGTTATATAGCTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	46.30%	0.70%	0.00%	NA
All Indica	2759	35.40%	63.60%	0.98%	0.00%	NA
All Japonica	1512	94.70%	5.10%	0.20%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	19.30%	79.80%	0.84%	0.00%	NA
Indica II	465	49.00%	50.30%	0.65%	0.00%	NA
Indica III	913	44.60%	54.30%	1.10%	0.00%	NA
Indica Intermediate	786	29.00%	69.80%	1.15%	0.00%	NA
Temperate Japonica	767	92.60%	7.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	95.00%	4.10%	0.83%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	40.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010358910	A -> G	LOC_Os10g20560.1	upstream_gene_variant ; 1193.0bp to feature; MODIFIER	silent_mutation	Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1010358910	A -> G	LOC_Os10g20540.1	downstream_gene_variant ; 4189.0bp to feature; MODIFIER	silent_mutation	Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1010358910	A -> G	LOC_Os10g20550.1	downstream_gene_variant ; 378.0bp to feature; MODIFIER	silent_mutation	Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1010358910	A -> G	LOC_Os10g20550-LOC_Os10g20560	intergenic_region ; MODIFIER	silent_mutation	Average:35.995; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010358910	5.58E-09	5.58E-09	mr1024	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	7.65E-07	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	4.86E-11	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	5.51E-23	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	7.44E-12	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	7.93E-06	mr1940	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	2.43E-07	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	1.72E-11	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010358910	NA	4.91E-13	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251