Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010348591:

Variant ID: vg1010348591 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10348591
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.25, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCAGAGGGCGTCGGAGAAGCCCTCCCCGTCACACACACACATGCCAATCTATCAGCCCGTGGCAATACATACGAGTAACATTTTGAAATGTGCAAAAG[A/G]
TCCAGAGTTTATGCTCTGTTCTTGCATTGTCACTTCGCTAGCCTCCATGACGTACAAATATTGGCTTTGTTTCTTACCTTTCTCTCAGCCATCATCTATT

Reverse complement sequence

AATAGATGATGGCTGAGAGAAAGGTAAGAAACAAAGCCAATATTTGTACGTCATGGAGGCTAGCGAAGTGACAATGCAAGAACAGAGCATAAACTCTGGA[T/C]
CTTTTGCACATTTCAAAATGTTACTCGTATGTATTGCCACGGGCTGATAGATTGGCATGTGTGTGTGTGACGGGGAGGGCTTCTCCGACGCCCTCTGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	26.20%	0.02%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.04%	0.00%	NA
All Japonica	1512	25.80%	74.20%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	12.40%	87.60%	0.00%	0.00%	NA
Tropical Japonica	504	43.70%	56.30%	0.00%	0.00%	NA
Japonica Intermediate	241	31.10%	68.90%	0.00%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010348591	A -> G	LOC_Os10g20520.1	upstream_gene_variant ; 4426.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N
vg1010348591	A -> G	LOC_Os10g20530.1	downstream_gene_variant ; 1215.0bp to feature; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N
vg1010348591	A -> G	LOC_Os10g20520-LOC_Os10g20530	intergenic_region ; MODIFIER	silent_mutation	Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010348591	NA	4.21E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	9.54E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	2.95E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	1.49E-08	mr1532	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	3.27E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	4.52E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	9.65E-13	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	2.44E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	2.95E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010348591	NA	1.21E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251