| Variant ID: vg1010348591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10348591 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.25, others allele: 0.00, population size: 218. )
TGTCAGAGGGCGTCGGAGAAGCCCTCCCCGTCACACACACACATGCCAATCTATCAGCCCGTGGCAATACATACGAGTAACATTTTGAAATGTGCAAAAG[A/G]
TCCAGAGTTTATGCTCTGTTCTTGCATTGTCACTTCGCTAGCCTCCATGACGTACAAATATTGGCTTTGTTTCTTACCTTTCTCTCAGCCATCATCTATT
AATAGATGATGGCTGAGAGAAAGGTAAGAAACAAAGCCAATATTTGTACGTCATGGAGGCTAGCGAAGTGACAATGCAAGAACAGAGCATAAACTCTGGA[T/C]
CTTTTGCACATTTCAAAATGTTACTCGTATGTATTGCCACGGGCTGATAGATTGGCATGTGTGTGTGTGACGGGGAGGGCTTCTCCGACGCCCTCTGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 26.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 25.80% | 74.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.40% | 87.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010348591 | A -> G | LOC_Os10g20520.1 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1010348591 | A -> G | LOC_Os10g20530.1 | downstream_gene_variant ; 1215.0bp to feature; MODIFIER | silent_mutation | Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1010348591 | A -> G | LOC_Os10g20520-LOC_Os10g20530 | intergenic_region ; MODIFIER | silent_mutation | Average:52.441; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010348591 | NA | 4.21E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 9.54E-12 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 2.95E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 1.49E-08 | mr1532 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 3.27E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 4.52E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 9.65E-13 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 2.44E-13 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 2.95E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010348591 | NA | 1.21E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |