\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010307395:

Variant ID: vg1010307395 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10307395
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTAACTAAAGTTAAACCATGAATTTAACTTTTGAATTCTAAAAAATTGACATAAAGAGTTTGCACTTTACATTTCTTTGCAAAGTACATATGTCAAAT[T/C]
TATTTTATAGAGTTTGAAACATTTGTTTTCATATTATTTCAATCAGAATATTCAATTAAAAACAATTAGTACAATAAATTCTGATTGAACATTGTCCCTG

Reverse complement sequence

CAGGGACAATGTTCAATCAGAATTTATTGTACTAATTGTTTTTAATTGAATATTCTGATTGAAATAATATGAAAACAAATGTTTCAAACTCTATAAAATA[A/G]
ATTTGACATATGTACTTTGCAAAGAAATGTAAAGTGCAAACTCTTTATGTCAATTTTTTAGAATTCAAAAGTTAAATTCATGGTTTAACTTTAGTTACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.00% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 22.30% 77.70% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010307395 T -> C LOC_Os10g20470.1 upstream_gene_variant ; 3000.0bp to feature; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 31.012 N N N N
vg1010307395 T -> C LOC_Os10g20470-LOC_Os10g20480 intergenic_region ; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 31.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010307395 NA 3.56E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 4.49E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 2.11E-12 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 2.46E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 6.27E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 2.23E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 3.07E-21 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 1.20E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 1.91E-07 NA mr1404_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 2.07E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 3.01E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 3.07E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 4.37E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 4.12E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 6.08E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 2.68E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 3.35E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010307395 NA 3.74E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251