\
| Variant ID: vg1010292912 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10292912 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTAGTAGTAGCTGGATTCAGATCTCTGATAGTCTGACAAACGACAACTAATTAAAATTACTACTTTTTTCTATAATGGAAATGATTTTAATCTCCGACC[T/C]
CTACCATAAGACACATAAGATGATGGGGCAGACCTTCAACTTTCTATAAATAAGTTCAACCTAAAAATACTTTCCAAAATCAATAAATTCTAGCACGTCA
TGACGTGCTAGAATTTATTGATTTTGGAAAGTATTTTTAGGTTGAACTTATTTATAGAAAGTTGAAGGTCTGCCCCATCATCTTATGTGTCTTATGGTAG[A/G]
GGTCGGAGATTAAAATCATTTCCATTATAGAAAAAAGTAGTAATTTTAATTAGTTGTCGTTTGTCAGACTATCAGAGATCTGAATCCAGCTACTACTAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010292912 | T -> C | LOC_Os10g20450.1 | upstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:70.644; most accessible tissue: Callus, score: 91.743 | N | N | N | N |
| vg1010292912 | T -> C | LOC_Os10g20440.1 | downstream_gene_variant ; 794.0bp to feature; MODIFIER | silent_mutation | Average:70.644; most accessible tissue: Callus, score: 91.743 | N | N | N | N |
| vg1010292912 | T -> C | LOC_Os10g20460.1 | downstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:70.644; most accessible tissue: Callus, score: 91.743 | N | N | N | N |
| vg1010292912 | T -> C | LOC_Os10g20440-LOC_Os10g20450 | intergenic_region ; MODIFIER | silent_mutation | Average:70.644; most accessible tissue: Callus, score: 91.743 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010292912 | NA | 3.77E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010292912 | 5.45E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010292912 | 2.49E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010292912 | 5.65E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010292912 | 1.24E-06 | NA | mr1619_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010292912 | 1.04E-06 | NA | mr1795_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |