\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010292912:

Variant ID: vg1010292912 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10292912
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTAGTAGTAGCTGGATTCAGATCTCTGATAGTCTGACAAACGACAACTAATTAAAATTACTACTTTTTTCTATAATGGAAATGATTTTAATCTCCGACC[T/C]
CTACCATAAGACACATAAGATGATGGGGCAGACCTTCAACTTTCTATAAATAAGTTCAACCTAAAAATACTTTCCAAAATCAATAAATTCTAGCACGTCA

Reverse complement sequence

TGACGTGCTAGAATTTATTGATTTTGGAAAGTATTTTTAGGTTGAACTTATTTATAGAAAGTTGAAGGTCTGCCCCATCATCTTATGTGTCTTATGGTAG[A/G]
GGTCGGAGATTAAAATCATTTCCATTATAGAAAAAAGTAGTAATTTTAATTAGTTGTCGTTTGTCAGACTATCAGAGATCTGAATCCAGCTACTACTAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.30% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010292912 T -> C LOC_Os10g20450.1 upstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Callus, score: 91.743 N N N N
vg1010292912 T -> C LOC_Os10g20440.1 downstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Callus, score: 91.743 N N N N
vg1010292912 T -> C LOC_Os10g20460.1 downstream_gene_variant ; 4162.0bp to feature; MODIFIER silent_mutation Average:70.644; most accessible tissue: Callus, score: 91.743 N N N N
vg1010292912 T -> C LOC_Os10g20440-LOC_Os10g20450 intergenic_region ; MODIFIER silent_mutation Average:70.644; most accessible tissue: Callus, score: 91.743 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010292912 NA 3.77E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010292912 5.45E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010292912 2.49E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010292912 5.65E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010292912 1.24E-06 NA mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010292912 1.04E-06 NA mr1795_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251