\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010268867:

Variant ID: vg1010268867 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10268867
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCATTTAAAAGACACTTAGTTGCCCAAAGCTATTTTATAAACACGATTCTAGAGCTACACAATATTATTAATCAAGGCCGTGGACCCTCACGAACCT[G/A]
CCTTAACCCAAGGCCTACGATGATTCGGACCGAACTGGCAACCCGACCTGGGTCCCAGCTCGTCCCAAGCCAACCCAGGCCAACCATTCCACATTTTAGT

Reverse complement sequence

ACTAAAATGTGGAATGGTTGGCCTGGGTTGGCTTGGGACGAGCTGGGACCCAGGTCGGGTTGCCAGTTCGGTCCGAATCATCGTAGGCCTTGGGTTAAGG[C/T]
AGGTTCGTGAGGGTCCACGGCCTTGATTAATAATATTGTGTAGCTCTAGAATCGTGTTTATAAAATAGCTTTGGGCAACTAAGTGTCTTTTAAATGCTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.70% 0.21% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 78.90% 20.40% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 62.20% 36.90% 0.91% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 92.10% 7.10% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010268867 G -> A LOC_Os10g20410.1 upstream_gene_variant ; 2345.0bp to feature; MODIFIER silent_mutation Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1010268867 G -> A LOC_Os10g20420.1 upstream_gene_variant ; 2242.0bp to feature; MODIFIER silent_mutation Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1010268867 G -> A LOC_Os10g20430.1 downstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1010268867 G -> A LOC_Os10g20410-LOC_Os10g20420 intergenic_region ; MODIFIER silent_mutation Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010268867 4.94E-11 4.27E-22 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010268867 NA 4.96E-09 mr1768 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010268867 1.30E-12 1.83E-32 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010268867 NA 5.44E-11 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251