\
| Variant ID: vg1010268867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10268867 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 254. )
AGAGCATTTAAAAGACACTTAGTTGCCCAAAGCTATTTTATAAACACGATTCTAGAGCTACACAATATTATTAATCAAGGCCGTGGACCCTCACGAACCT[G/A]
CCTTAACCCAAGGCCTACGATGATTCGGACCGAACTGGCAACCCGACCTGGGTCCCAGCTCGTCCCAAGCCAACCCAGGCCAACCATTCCACATTTTAGT
ACTAAAATGTGGAATGGTTGGCCTGGGTTGGCTTGGGACGAGCTGGGACCCAGGTCGGGTTGCCAGTTCGGTCCGAATCATCGTAGGCCTTGGGTTAAGG[C/T]
AGGTTCGTGAGGGTCCACGGCCTTGATTAATAATATTGTGTAGCTCTAGAATCGTGTTTATAAAATAGCTTTGGGCAACTAAGTGTCTTTTAAATGCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.70% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.90% | 20.40% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 62.20% | 36.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010268867 | G -> A | LOC_Os10g20410.1 | upstream_gene_variant ; 2345.0bp to feature; MODIFIER | silent_mutation | Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg1010268867 | G -> A | LOC_Os10g20420.1 | upstream_gene_variant ; 2242.0bp to feature; MODIFIER | silent_mutation | Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg1010268867 | G -> A | LOC_Os10g20430.1 | downstream_gene_variant ; 3937.0bp to feature; MODIFIER | silent_mutation | Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg1010268867 | G -> A | LOC_Os10g20410-LOC_Os10g20420 | intergenic_region ; MODIFIER | silent_mutation | Average:51.511; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010268867 | 4.94E-11 | 4.27E-22 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010268867 | NA | 4.96E-09 | mr1768 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010268867 | 1.30E-12 | 1.83E-32 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010268867 | NA | 5.44E-11 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |