Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010257353:

Variant ID: vg1010257353 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10257353
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTGAGAAATCTTTTAAGCCTAATTACGTCATAATTTGATAATATGGTGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGCTTAAAAAATTCGT[T/C]
TCGCAGTTTCATGGTGGAATTTATAATTTGTTTTGTTATTAGACTACGTTCAATACTTGAAATGTGTGTCCGTATATCCGATGTAACATGTGTGAGCAAA

Reverse complement sequence

TTTGCTCACACATGTTACATCGGATATACGGACACACATTTCAAGTATTGAACGTAGTCTAATAACAAAACAAATTATAAATTCCACCATGAAACTGCGA[A/G]
ACGAATTTTTTAAGCCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCACCATATTATCAAATTATGACGTAATTAGGCTTAAAAGATTTCTCACAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	11.70%	0.04%	0.00%	NA
All Indica	2759	96.80%	3.20%	0.04%	0.00%	NA
All Japonica	1512	86.40%	13.60%	0.00%	0.00%	NA
Aus	269	22.70%	77.30%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	5.90%	0.13%	0.00%	NA
Temperate Japonica	767	91.30%	8.70%	0.00%	0.00%	NA
Tropical Japonica	504	79.60%	20.40%	0.00%	0.00%	NA
Japonica Intermediate	241	85.50%	14.50%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010257353	T -> C	LOC_Os10g20390.1	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:37.798; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1010257353	T -> C	LOC_Os10g20400.1	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:37.798; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1010257353	T -> C	LOC_Os10g20390-LOC_Os10g20400	intergenic_region ; MODIFIER	silent_mutation	Average:37.798; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010257353	NA	1.76E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	6.89E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	1.79E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	9.16E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	9.36E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	5.54E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	1.75E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	1.24E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010257353	NA	6.55E-08	mr1834_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251