\
| Variant ID: vg1010257353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10257353 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTGTGAGAAATCTTTTAAGCCTAATTACGTCATAATTTGATAATATGGTGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGCTTAAAAAATTCGT[T/C]
TCGCAGTTTCATGGTGGAATTTATAATTTGTTTTGTTATTAGACTACGTTCAATACTTGAAATGTGTGTCCGTATATCCGATGTAACATGTGTGAGCAAA
TTTGCTCACACATGTTACATCGGATATACGGACACACATTTCAAGTATTGAACGTAGTCTAATAACAAAACAAATTATAAATTCCACCATGAAACTGCGA[A/G]
ACGAATTTTTTAAGCCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCACCATATTATCAAATTATGACGTAATTAGGCTTAAAAGATTTCTCACAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 11.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.70% | 77.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010257353 | T -> C | LOC_Os10g20390.1 | upstream_gene_variant ; 4791.0bp to feature; MODIFIER | silent_mutation | Average:37.798; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| vg1010257353 | T -> C | LOC_Os10g20400.1 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:37.798; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| vg1010257353 | T -> C | LOC_Os10g20390-LOC_Os10g20400 | intergenic_region ; MODIFIER | silent_mutation | Average:37.798; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010257353 | NA | 1.76E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 6.89E-12 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 1.79E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 9.16E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 9.36E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 5.54E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 1.75E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 1.24E-08 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010257353 | NA | 6.55E-08 | mr1834_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |