\
| Variant ID: vg1010255814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10255814 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 111. )
TAATCTTGTTTACACCCAAATTTGGCACCTAGGAGTAAGATAGGAAAAATTGCCAAATTTTAGAAATCTGCCGGTTTCCTCCGAGTAGGCCAGTCTGACC[G/A]
CCGTGTGTTGGCCGGTCAGACCGCCGGTTGAGGGCCGGTCAGACCAGCGGCATGTGGATGGTCTGACCGGCAGGTCCGAGTCCGAGTGTGTGTTTCGCCG
CGGCGAAACACACACTCGGACTCGGACCTGCCGGTCAGACCATCCACATGCCGCTGGTCTGACCGGCCCTCAACCGGCGGTCTGACCGGCCAACACACGG[C/T]
GGTCAGACTGGCCTACTCGGAGGAAACCGGCAGATTTCTAAAATTTGGCAATTTTTCCTATCTTACTCCTAGGTGCCAAATTTGGGTGTAAACAAGATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.20% | 0.40% | 0.21% | NA |
| All Indica | 2759 | 60.90% | 38.30% | 0.51% | 0.33% | NA |
| All Japonica | 1512 | 78.40% | 21.50% | 0.00% | 0.07% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.50% | 22.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 50.30% | 48.40% | 0.86% | 0.43% | NA |
| Indica III | 913 | 52.50% | 46.40% | 0.55% | 0.55% | NA |
| Indica Intermediate | 786 | 64.40% | 35.10% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.50% | 42.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 29.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 36.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010255814 | G -> A | LOC_Os10g20390.1 | upstream_gene_variant ; 3252.0bp to feature; MODIFIER | silent_mutation | Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg1010255814 | G -> A | LOC_Os10g20400.1 | upstream_gene_variant ; 2972.0bp to feature; MODIFIER | silent_mutation | Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg1010255814 | G -> A | LOC_Os10g20390-LOC_Os10g20400 | intergenic_region ; MODIFIER | silent_mutation | Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg1010255814 | G -> DEL | N | N | silent_mutation | Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010255814 | NA | 3.11E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 1.13E-11 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 1.05E-09 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 1.51E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 7.39E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | 7.49E-07 | 1.39E-07 | mr1729 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 7.09E-07 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 3.70E-14 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 4.20E-13 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010255814 | NA | 1.90E-15 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |