\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010255814:

Variant ID: vg1010255814 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10255814
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCTTGTTTACACCCAAATTTGGCACCTAGGAGTAAGATAGGAAAAATTGCCAAATTTTAGAAATCTGCCGGTTTCCTCCGAGTAGGCCAGTCTGACC[G/A]
CCGTGTGTTGGCCGGTCAGACCGCCGGTTGAGGGCCGGTCAGACCAGCGGCATGTGGATGGTCTGACCGGCAGGTCCGAGTCCGAGTGTGTGTTTCGCCG

Reverse complement sequence

CGGCGAAACACACACTCGGACTCGGACCTGCCGGTCAGACCATCCACATGCCGCTGGTCTGACCGGCCCTCAACCGGCGGTCTGACCGGCCAACACACGG[C/T]
GGTCAGACTGGCCTACTCGGAGGAAACCGGCAGATTTCTAAAATTTGGCAATTTTTCCTATCTTACTCCTAGGTGCCAAATTTGGGTGTAAACAAGATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.20% 0.40% 0.21% NA
All Indica  2759 60.90% 38.30% 0.51% 0.33% NA
All Japonica  1512 78.40% 21.50% 0.00% 0.07% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 77.50% 22.00% 0.34% 0.17% NA
Indica II  465 50.30% 48.40% 0.86% 0.43% NA
Indica III  913 52.50% 46.40% 0.55% 0.55% NA
Indica Intermediate  786 64.40% 35.10% 0.38% 0.13% NA
Temperate Japonica  767 94.80% 5.20% 0.00% 0.00% NA
Tropical Japonica  504 57.50% 42.50% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.50% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 58.90% 36.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010255814 G -> A LOC_Os10g20390.1 upstream_gene_variant ; 3252.0bp to feature; MODIFIER silent_mutation Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1010255814 G -> A LOC_Os10g20400.1 upstream_gene_variant ; 2972.0bp to feature; MODIFIER silent_mutation Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1010255814 G -> A LOC_Os10g20390-LOC_Os10g20400 intergenic_region ; MODIFIER silent_mutation Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg1010255814 G -> DEL N N silent_mutation Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010255814 NA 3.11E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 1.13E-11 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 1.05E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 1.51E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 7.39E-12 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 7.49E-07 1.39E-07 mr1729 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 7.09E-07 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 3.70E-14 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 4.20E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814 NA 1.90E-15 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251