Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010229159:

Variant ID: vg1010229159 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10229159
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGGCTCGATCCCTTTTGGGGAGTGCCACGTGGGTACCGGGGGCAGCCCCCTCCCTCAAGTCTTAATACCCTCGGGCGAGGAGGGGGCTGCCGCCACTC[C/T]
ACCCCGGGCCCAACCCTCCTCGGGGGAGTGCCACGTGGGTATGAGGGCGGCCTCCTCCCTCTAAACATGATACCCCCGAGTCTATATCACCAACAATATG

Reverse complement sequence

CATATTGTTGGTGATATAGACTCGGGGGTATCATGTTTAGAGGGAGGAGGCCGCCCTCATACCCACGTGGCACTCCCCCGAGGAGGGTTGGGCCCGGGGT[G/A]
GAGTGGCGGCAGCCCCCTCCTCGCCCGAGGGTATTAAGACTTGAGGGAGGGGGCTGCCCCCGGTACCCACGTGGCACTCCCCAAAAGGGATCGAGCCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 3.50% 0.00% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 77.70% 22.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010229159 C -> T LOC_Os10g20340.1 upstream_gene_variant ; 1550.0bp to feature; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg1010229159 C -> T LOC_Os10g20320.1 downstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg1010229159 C -> T LOC_Os10g20330.1 downstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg1010229159 C -> T LOC_Os10g20350.1 downstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg1010229159 C -> T LOC_Os10g20350.2 downstream_gene_variant ; 2643.0bp to feature; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N
vg1010229159 C -> T LOC_Os10g20330-LOC_Os10g20340 intergenic_region ; MODIFIER silent_mutation Average:78.991; most accessible tissue: Zhenshan97 young leaf, score: 91.311 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1010229159 C T 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010229159 NA 1.58E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010229159 4.26E-06 NA mr1402_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010229159 3.05E-06 NA mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010229159 1.06E-06 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251