\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010178899:

Variant ID: vg1010178899 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10178899
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTGAAGATGTTTTTACCAATACTTTGGTAGGTCAATTGTATTTGAGTCGGTTTCAAAGTTCGTTCGCTTTTGAAAATATAGATACGTGTTTGAGTC[C/T]
GTTTTTAATTTTTTTCGCTTTTAAAAATACATAAGGAGTCGTATAAGAAATCTCTTTTAAAAAAAACTCTCACGCTAACTTGGGATTCTTTTAGAAATAC

Reverse complement sequence

GTATTTCTAAAAGAATCCCAAGTTAGCGTGAGAGTTTTTTTTAAAAGAGATTTCTTATACGACTCCTTATGTATTTTTAAAAGCGAAAAAAATTAAAAAC[G/A]
GACTCAAACACGTATCTATATTTTCAAAAGCGAACGAACTTTGAAACCGACTCAAATACAATTGACCTACCAAAGTATTGGTAAAAACATCTTCAATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 37.10% 0.06% 0.00% NA
All Indica  2759 94.30% 5.50% 0.11% 0.00% NA
All Japonica  1512 21.40% 78.60% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 97.00% 2.50% 0.50% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 93.90% 6.10% 0.00% 0.00% NA
Indica Intermediate  786 90.80% 9.20% 0.00% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 42.30% 57.70% 0.00% 0.00% NA
Japonica Intermediate  241 27.40% 72.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010178899 C -> T LOC_Os10g20250.1 upstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1010178899 C -> T LOC_Os10g20240.1 downstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1010178899 C -> T LOC_Os10g20260.1 downstream_gene_variant ; 1523.0bp to feature; MODIFIER silent_mutation Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1010178899 C -> T LOC_Os10g20250-LOC_Os10g20260 intergenic_region ; MODIFIER silent_mutation Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010178899 NA 1.05E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.23E-34 mr1221 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 1.57E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 4.12E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.48E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.15E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.83E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 1.16E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 6.25E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 4.47E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 4.64E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 5.96E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.84E-37 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 4.63E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 2.57E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 3.87E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899 NA 1.94E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251