Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010178899:

Variant ID: vg1010178899 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10178899
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATTGAAGATGTTTTTACCAATACTTTGGTAGGTCAATTGTATTTGAGTCGGTTTCAAAGTTCGTTCGCTTTTGAAAATATAGATACGTGTTTGAGTC[C/T]
GTTTTTAATTTTTTTCGCTTTTAAAAATACATAAGGAGTCGTATAAGAAATCTCTTTTAAAAAAAACTCTCACGCTAACTTGGGATTCTTTTAGAAATAC

Reverse complement sequence

GTATTTCTAAAAGAATCCCAAGTTAGCGTGAGAGTTTTTTTTAAAAGAGATTTCTTATACGACTCCTTATGTATTTTTAAAAGCGAAAAAAATTAAAAAC[G/A]
GACTCAAACACGTATCTATATTTTCAAAAGCGAACGAACTTTGAAACCGACTCAAATACAATTGACCTACCAAAGTATTGGTAAAAACATCTTCAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	37.10%	0.06%	0.00%	NA
All Indica	2759	94.30%	5.50%	0.11%	0.00%	NA
All Japonica	1512	21.40%	78.60%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	97.00%	2.50%	0.50%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	93.90%	6.10%	0.00%	0.00%	NA
Indica Intermediate	786	90.80%	9.20%	0.00%	0.00%	NA
Temperate Japonica	767	5.70%	94.30%	0.00%	0.00%	NA
Tropical Japonica	504	42.30%	57.70%	0.00%	0.00%	NA
Japonica Intermediate	241	27.40%	72.60%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010178899	C -> T	LOC_Os10g20250.1	upstream_gene_variant ; 1573.0bp to feature; MODIFIER	silent_mutation	Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1010178899	C -> T	LOC_Os10g20240.1	downstream_gene_variant ; 4425.0bp to feature; MODIFIER	silent_mutation	Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1010178899	C -> T	LOC_Os10g20260.1	downstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1010178899	C -> T	LOC_Os10g20250-LOC_Os10g20260	intergenic_region ; MODIFIER	silent_mutation	Average:36.133; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010178899	NA	1.05E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.23E-34	mr1221	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	1.57E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	4.12E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.48E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.15E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.83E-16	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	1.16E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	6.25E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	4.47E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	4.64E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	5.96E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.84E-37	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	4.63E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	2.57E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	3.87E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010178899	NA	1.94E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251