\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010153625:

Variant ID: vg1010153625 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10153625
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


GACATCAGAAGTCGTGATCGGTTATAGGAGTTTATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGAATAAGGTATACCCTCTACCCTTGGATGTA[C/T]
GCTATACGGCAATACGGTACATCGGCGCGTGTACGGACGTTCTCTGTATACGTTAAGGAAATTCATCTCAAAGTCCACCAATGGAAAGGTTCCTACCCAT

Reverse complement sequence

ATGGGTAGGAACCTTTCCATTGGTGGACTTTGAGATGAATTTCCTTAACGTATACAGAGAACGTCCGTACACGCGCCGATGTACCGTATTGCCGTATAGC[G/A]
TACATCCAAGGGTAGAGGGTATACCTTATTCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATAAACTCCTATAACCGATCACGACTTCTGATGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 2.50% 0.63% 3.26% NA
All Indica  2759 99.70% 0.00% 0.14% 0.14% NA
All Japonica  1512 80.90% 7.80% 1.59% 9.72% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.20% 0.00% 0.25% 0.51% NA
Temperate Japonica  767 79.70% 12.50% 0.91% 6.91% NA
Tropical Japonica  504 78.00% 4.00% 2.18% 15.87% NA
Japonica Intermediate  241 90.90% 0.80% 2.49% 5.81% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010153625 C -> T LOC_Os10g20220.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg1010153625 C -> T LOC_Os10g20220-LOC_Os10g20230 intergenic_region ; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg1010153625 C -> DEL N N silent_mutation Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010153625 NA 2.13E-07 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 2.02E-06 mr1007 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 7.12E-07 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 7.69E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 5.30E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 5.95E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 4.74E-06 4.74E-06 mr1812 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 6.06E-06 1.85E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625 NA 1.34E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251