Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010153625:

Variant ID: vg1010153625 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10153625
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

GACATCAGAAGTCGTGATCGGTTATAGGAGTTTATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGAATAAGGTATACCCTCTACCCTTGGATGTA[C/T]
GCTATACGGCAATACGGTACATCGGCGCGTGTACGGACGTTCTCTGTATACGTTAAGGAAATTCATCTCAAAGTCCACCAATGGAAAGGTTCCTACCCAT

Reverse complement sequence

ATGGGTAGGAACCTTTCCATTGGTGGACTTTGAGATGAATTTCCTTAACGTATACAGAGAACGTCCGTACACGCGCCGATGTACCGTATTGCCGTATAGC[G/A]
TACATCCAAGGGTAGAGGGTATACCTTATTCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATAAACTCCTATAACCGATCACGACTTCTGATGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	2.50%	0.63%	3.26%	NA
All Indica	2759	99.70%	0.00%	0.14%	0.14%	NA
All Japonica	1512	80.90%	7.80%	1.59%	9.72%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.20%	0.00%	0.25%	0.51%	NA
Temperate Japonica	767	79.70%	12.50%	0.91%	6.91%	NA
Tropical Japonica	504	78.00%	4.00%	2.18%	15.87%	NA
Japonica Intermediate	241	90.90%	0.80%	2.49%	5.81%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010153625	C -> T	LOC_Os10g20220.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N
vg1010153625	C -> T	LOC_Os10g20220-LOC_Os10g20230	intergenic_region ; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N
vg1010153625	C -> DEL	N	N	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010153625	NA	2.13E-07	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	2.02E-06	mr1007	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	7.12E-07	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	7.69E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	5.30E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	5.95E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	4.74E-06	4.74E-06	mr1812	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	6.06E-06	1.85E-07	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153625	NA	1.34E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251