\
| Variant ID: vg1010153625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10153625 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
GACATCAGAAGTCGTGATCGGTTATAGGAGTTTATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGAATAAGGTATACCCTCTACCCTTGGATGTA[C/T]
GCTATACGGCAATACGGTACATCGGCGCGTGTACGGACGTTCTCTGTATACGTTAAGGAAATTCATCTCAAAGTCCACCAATGGAAAGGTTCCTACCCAT
ATGGGTAGGAACCTTTCCATTGGTGGACTTTGAGATGAATTTCCTTAACGTATACAGAGAACGTCCGTACACGCGCCGATGTACCGTATTGCCGTATAGC[G/A]
TACATCCAAGGGTAGAGGGTATACCTTATTCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATAAACTCCTATAACCGATCACGACTTCTGATGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 2.50% | 0.63% | 3.26% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.14% | 0.14% | NA |
| All Japonica | 1512 | 80.90% | 7.80% | 1.59% | 9.72% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.00% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 79.70% | 12.50% | 0.91% | 6.91% | NA |
| Tropical Japonica | 504 | 78.00% | 4.00% | 2.18% | 15.87% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.80% | 2.49% | 5.81% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010153625 | C -> T | LOC_Os10g20220.1 | upstream_gene_variant ; 444.0bp to feature; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| vg1010153625 | C -> T | LOC_Os10g20220-LOC_Os10g20230 | intergenic_region ; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| vg1010153625 | C -> DEL | N | N | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010153625 | NA | 2.13E-07 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 2.02E-06 | mr1007 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 7.12E-07 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 7.69E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 5.30E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 5.95E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | 4.74E-06 | 4.74E-06 | mr1812 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | 6.06E-06 | 1.85E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010153625 | NA | 1.34E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |