\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010153418:

Variant ID: vg1010153418 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10153418
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAATAGGCGCACTACCGACGGTGCGAATTCCAAGGAAAGGAGAGAGATGGCCGTCGGAAATTTCTGGGTCCGTTGCGCGAGGCGGTTTCTCGGACTTC[A/C]
ATTTAAATTCACTCATAACCGTTGAACTTCGCCTGGTGTTGTCGATCACTCCTTGTCTCTACGATCCCCACACCGAGATCGACCAGTCGAGAACGACAAC

Reverse complement sequence

GTTGTCGTTCTCGACTGGTCGATCTCGGTGTGGGGATCGTAGAGACAAGGAGTGATCGACAACACCAGGCGAAGTTCAACGGTTATGAGTGAATTTAAAT[T/G]
GAAGTCCGAGAAACCGCCTCGCGCAACGGACCCAGAAATTTCCGACGGCCATCTCTCTCCTTTCCTTGGAATTCGCACCGTCGGTAGTGCGCCTATTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 2.50% 0.47% 3.13% NA
All Indica  2759 99.70% 0.00% 0.11% 0.14% NA
All Japonica  1512 81.60% 7.90% 1.06% 9.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.00% 0.13% 0.51% NA
Temperate Japonica  767 80.10% 13.70% 0.39% 5.87% NA
Tropical Japonica  504 79.80% 2.40% 1.98% 15.87% NA
Japonica Intermediate  241 90.50% 1.20% 1.24% 7.05% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010153418 A -> C LOC_Os10g20220.1 upstream_gene_variant ; 237.0bp to feature; MODIFIER silent_mutation Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1010153418 A -> C LOC_Os10g20220-LOC_Os10g20230 intergenic_region ; MODIFIER silent_mutation Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1010153418 A -> DEL N N silent_mutation Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010153418 NA 4.42E-07 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 1.72E-06 mr1007 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 8.33E-07 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 9.03E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 1.10E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 1.02E-07 1.02E-07 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 1.44E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 3.60E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 2.00E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 9.45E-06 8.97E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 NA 2.71E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418 3.20E-06 4.81E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251