Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010153418:

Variant ID: vg1010153418 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10153418
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAATAGGCGCACTACCGACGGTGCGAATTCCAAGGAAAGGAGAGAGATGGCCGTCGGAAATTTCTGGGTCCGTTGCGCGAGGCGGTTTCTCGGACTTC[A/C]
ATTTAAATTCACTCATAACCGTTGAACTTCGCCTGGTGTTGTCGATCACTCCTTGTCTCTACGATCCCCACACCGAGATCGACCAGTCGAGAACGACAAC

Reverse complement sequence

GTTGTCGTTCTCGACTGGTCGATCTCGGTGTGGGGATCGTAGAGACAAGGAGTGATCGACAACACCAGGCGAAGTTCAACGGTTATGAGTGAATTTAAAT[T/G]
GAAGTCCGAGAAACCGCCTCGCGCAACGGACCCAGAAATTTCCGACGGCCATCTCTCTCCTTTCCTTGGAATTCGCACCGTCGGTAGTGCGCCTATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	2.50%	0.47%	3.13%	NA
All Indica	2759	99.70%	0.00%	0.11%	0.14%	NA
All Japonica	1512	81.60%	7.90%	1.06%	9.39%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.00%	0.13%	0.51%	NA
Temperate Japonica	767	80.10%	13.70%	0.39%	5.87%	NA
Tropical Japonica	504	79.80%	2.40%	1.98%	15.87%	NA
Japonica Intermediate	241	90.50%	1.20%	1.24%	7.05%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010153418	A -> C	LOC_Os10g20220.1	upstream_gene_variant ; 237.0bp to feature; MODIFIER	silent_mutation	Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg1010153418	A -> C	LOC_Os10g20220-LOC_Os10g20230	intergenic_region ; MODIFIER	silent_mutation	Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg1010153418	A -> DEL	N	N	silent_mutation	Average:54.484; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010153418	NA	4.42E-07	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	1.72E-06	mr1007	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	8.33E-07	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	9.03E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	1.10E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	1.02E-07	1.02E-07	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	1.44E-06	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	3.60E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	2.00E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	9.45E-06	8.97E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	NA	2.71E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010153418	3.20E-06	4.81E-12	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251