Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010146858:

Variant ID: vg1010146858 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10146858
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGGATTCTTCAGAGACGAAAGACCATATAAGATCTGGTCGTGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGATTTTCCA[A/G]
CTTCACGGCTGGGGGCTAGGATCAGTGTTTATTCAACTAAGGCAAGTCAAAGGTCTAAGAGCCTTATCTTCCGAGAAGAATTCTCCGACGACAAGGCTGG

Reverse complement sequence

CCAGCCTTGTCGTCGGAGAATTCTTCTCGGAAGATAAGGCTCTTAGACCTTTGACTTGCCTTAGTTGAATAAACACTGATCCTAGCCCCCAGCCGTGAAG[T/C]
TGGAAAATCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACACGACCAGATCTTATATGGTCTTTCGTCTCTGAAGAATCCGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	18.40%	0.49%	4.53%	NA
All Indica	2759	67.10%	30.60%	0.72%	1.67%	NA
All Japonica	1512	88.20%	0.70%	0.20%	10.91%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	28.20%	67.90%	2.02%	1.85%	NA
Indica II	465	83.00%	15.50%	0.22%	1.29%	NA
Indica III	913	80.70%	17.50%	0.22%	1.53%	NA
Indica Intermediate	786	71.10%	26.30%	0.64%	1.91%	NA
Temperate Japonica	767	93.00%	0.70%	0.26%	6.13%	NA
Tropical Japonica	504	80.40%	0.80%	0.00%	18.85%	NA
Japonica Intermediate	241	89.60%	0.40%	0.41%	9.54%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	11.10%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010146858	A -> G	LOC_Os10g20190.1	upstream_gene_variant ; 4427.0bp to feature; MODIFIER	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1010146858	A -> G	LOC_Os10g20200.1	downstream_gene_variant ; 621.0bp to feature; MODIFIER	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1010146858	A -> G	LOC_Os10g20210.1	downstream_gene_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1010146858	A -> G	LOC_Os10g20220.1	downstream_gene_variant ; 3462.0bp to feature; MODIFIER	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1010146858	A -> G	LOC_Os10g20200-LOC_Os10g20210	intergenic_region ; MODIFIER	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1010146858	A -> DEL	N	N	silent_mutation	Average:44.887; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010146858	5.89E-07	4.12E-36	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	1.33E-06	3.33E-19	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	5.54E-06	6.90E-14	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	1.60E-06	6.28E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	1.85E-06	2.77E-17	mr1161	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	7.80E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	3.11E-07	2.11E-17	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	1.75E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	3.70E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	2.50E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	1.25E-16	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	5.91E-18	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	1.18E-06	6.00E-39	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	2.94E-22	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	9.80E-24	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	1.76E-19	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	1.84E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010146858	NA	1.67E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251