\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010133100:

Variant ID: vg1010133100 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10133100
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGATTACAAATGCTCTAGCCTGAGTTGTCTAAGTATCTCGCAGAAGTCAGGAAGCTGGAAAAAAGATTTGATGGGATCGAGGTCCGACACGTATATC[A/G]
CAAGAACAACATCGAGTCGGACGATCTAGCACGGCGTGCGTCCAGACGAGAGCCACTCGAACCCAGCACCTTTCTGGACATCCTGACAAAGCCATCAGTG

Reverse complement sequence

CACTGATGGCTTTGTCAGGATGTCCAGAAAGGTGCTGGGTTCGAGTGGCTCTCGTCTGGACGCACGCCGTGCTAGATCGTCCGACTCGATGTTGTTCTTG[T/C]
GATATACGTGTCGGACCTCGATCCCATCAAATCTTTTTTCCAGCTTCCTGACTTCTGCGAGATACTTAGACAACTCAGGCTAGAGCATTTGTAATCTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 43.30% 5.99% 4.49% NA
All Indica  2759 48.10% 34.70% 9.82% 7.47% NA
All Japonica  1512 35.60% 63.80% 0.46% 0.13% NA
Aus  269 81.40% 18.20% 0.37% 0.00% NA
Indica I  595 23.70% 72.40% 2.18% 1.68% NA
Indica II  465 63.90% 17.00% 11.40% 7.74% NA
Indica III  913 52.40% 20.50% 15.66% 11.50% NA
Indica Intermediate  786 52.20% 33.00% 7.89% 7.00% NA
Temperate Japonica  767 15.30% 84.50% 0.13% 0.13% NA
Tropical Japonica  504 67.10% 31.50% 1.19% 0.20% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 40.60% 1.04% 0.00% NA
Intermediate  90 48.90% 43.30% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010133100 A -> G LOC_Os10g20170.1 downstream_gene_variant ; 1750.0bp to feature; MODIFIER silent_mutation Average:48.019; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1010133100 A -> G LOC_Os10g20190.1 downstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:48.019; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1010133100 A -> G LOC_Os10g20180.1 intron_variant ; MODIFIER silent_mutation Average:48.019; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1010133100 A -> DEL N N silent_mutation Average:48.019; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010133100 NA 7.82E-17 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 4.25E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 4.53E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 4.48E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 6.42E-15 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 1.29E-07 mr1194 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 2.71E-13 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 1.29E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 9.01E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 6.51E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 9.32E-17 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 2.73E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 5.26E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 2.33E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 1.40E-16 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 2.06E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010133100 NA 6.84E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251