\
| Variant ID: vg1010067602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10067602 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTGAATCCGAGCTGCTTGTTCGTGAGAGCCATTCCCAGTTATAGAACCAGTGATATGTTCGAAGATAGTCTACAGAGGTCAGATTAAAATCACCTCTA[A/G,C]
CAGCGAAGCTTCAGATCTGGCAGGATAATGATTAGACAATAACAAGTCCAGCAGCAAAGTCATTCGGGAAGACGTCAAAGCATGTCAAGTGGGATAAATT
AATTTATCCCACTTGACATGCTTTGACGTCTTCCCGAATGACTTTGCTGCTGGACTTGTTATTGTCTAATCATTATCCTGCCAGATCTGAAGCTTCGCTG[T/C,G]
TAGAGGTGATTTTAATCTGACCTCTGTAGACTATCTTCGAACATATCACTGGTTCTATAACTGGGAATGGCTCTCACGAACAAGCAGCTCGGATTCACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 9.00% | 18.75% | 5.40% | C: 0.04% |
| All Indica | 2759 | 71.40% | 6.60% | 12.98% | 8.88% | C: 0.07% |
| All Japonica | 1512 | 62.20% | 12.30% | 25.07% | 0.46% | NA |
| Aus | 269 | 36.40% | 16.00% | 47.58% | 0.00% | NA |
| Indica I | 595 | 66.90% | 6.10% | 18.32% | 8.57% | C: 0.17% |
| Indica II | 465 | 77.60% | 3.40% | 10.32% | 8.60% | NA |
| Indica III | 913 | 69.70% | 8.80% | 10.73% | 10.73% | C: 0.11% |
| Indica Intermediate | 786 | 73.30% | 6.50% | 13.10% | 7.12% | NA |
| Temperate Japonica | 767 | 83.60% | 1.70% | 14.60% | 0.13% | NA |
| Tropical Japonica | 504 | 28.60% | 30.40% | 40.28% | 0.79% | NA |
| Japonica Intermediate | 241 | 64.30% | 8.30% | 26.56% | 0.83% | NA |
| VI/Aromatic | 96 | 85.40% | 2.10% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 11.10% | 10.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010067602 | A -> C | LOC_Os10g20050.1 | downstream_gene_variant ; 1204.0bp to feature; MODIFIER | silent_mutation | Average:22.138; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1010067602 | A -> C | LOC_Os10g20050-LOC_Os10g20060 | intergenic_region ; MODIFIER | silent_mutation | Average:22.138; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1010067602 | A -> G | LOC_Os10g20050.1 | downstream_gene_variant ; 1204.0bp to feature; MODIFIER | silent_mutation | Average:22.138; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1010067602 | A -> G | LOC_Os10g20050-LOC_Os10g20060 | intergenic_region ; MODIFIER | silent_mutation | Average:22.138; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg1010067602 | A -> DEL | N | N | silent_mutation | Average:22.138; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010067602 | NA | 4.65E-06 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010067602 | 5.04E-06 | 4.92E-07 | mr1585_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010067602 | NA | 2.65E-07 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010067602 | NA | 4.66E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |