\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010028847:

Variant ID: vg1010028847 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10028847
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGAAATTTAGCCCAAATTTCTGGACTATTTTGTGTATGAGGTCCCTATTCAGGAATCAGCCAGGGTACACAAAACAACAAGTAAATATACAGATCCAAA[C/T]
GTAAATAAATCGTAAATACTTATAGCAGAGGCACTTAGTCCTTACACCGAAAAGAAAGCAGCAGCAGTAGCGGAAAAGGGGATCCTAGTGGGGCTTCAGC

Reverse complement sequence

GCTGAAGCCCCACTAGGATCCCCTTTTCCGCTACTGCTGCTGCTTTCTTTTCGGTGTAAGGACTAAGTGCCTCTGCTATAAGTATTTACGATTTATTTAC[G/A]
TTTGGATCTGTATATTTACTTGTTGTTTTGTGTACCCTGGCTGATTCCTGAATAGGGACCTCATACACAAAATAGTCCAGAAATTTGGGCTAAATTTCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 24.40% 0.47% 17.39% NA
All Indica  2759 67.30% 2.80% 0.76% 29.18% NA
All Japonica  1512 33.30% 66.00% 0.07% 0.60% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 28.60% 3.00% 1.85% 66.55% NA
Indica II  465 82.80% 1.90% 0.43% 14.84% NA
Indica III  913 81.90% 3.20% 0.33% 14.57% NA
Indica Intermediate  786 70.40% 2.70% 0.64% 26.34% NA
Temperate Japonica  767 11.60% 87.70% 0.00% 0.65% NA
Tropical Japonica  504 62.90% 36.50% 0.20% 0.40% NA
Japonica Intermediate  241 40.70% 58.50% 0.00% 0.83% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 51.10% 40.00% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010028847 C -> T LOC_Os10g20000.1 upstream_gene_variant ; 3528.0bp to feature; MODIFIER silent_mutation Average:48.865; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg1010028847 C -> T LOC_Os10g19980.1 downstream_gene_variant ; 1991.0bp to feature; MODIFIER silent_mutation Average:48.865; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg1010028847 C -> T LOC_Os10g19990.1 intron_variant ; MODIFIER silent_mutation Average:48.865; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg1010028847 C -> DEL N N silent_mutation Average:48.865; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1010028847 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010028847 NA 1.60E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 2.85E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 1.28E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 2.34E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 4.00E-06 NA mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 1.97E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 2.12E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 6.86E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010028847 NA 3.07E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251