\
| Variant ID: vg1010015339 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10015339 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 209. )
GGAAGAAAATTTTATATTACCAGCCAGTCCAGTTCTCTGTCCACATTTTAGGGATGCTTGTCCTGTTTGAAAACCACTCATGGCAATAGAATCCATTACA[G/A]
GTGTTGACCTAAATTTGTCAGAAAAATGATGACATGCATTTCATTCAACCAAACAATGCAATAATAAACTTAAATATAGAATATTTTGAATTGCAATCGA
TCGATTGCAATTCAAAATATTCTATATTTAAGTTTATTATTGCATTGTTTGGTTGAATGAAATGCATGTCATCATTTTTCTGACAAATTTAGGTCAACAC[C/T]
TGTAATGGATTCTATTGCCATGAGTGGTTTTCAAACAGGACAAGCATCCCTAAAATGTGGACAGAGAACTGGACTGGCTGGTAATATAAAATTTTCTTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 32.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 5.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 12.40% | 87.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.30% | 37.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 61.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010015339 | G -> A | LOC_Os10g19960.1 | synonymous_variant ; p.Thr237Thr; LOW | synonymous_codon | Average:51.138; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010015339 | NA | 2.55E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 6.29E-15 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | 5.81E-06 | 5.81E-06 | mr1260 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | 3.26E-07 | 5.69E-10 | mr1261 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 7.29E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 5.66E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 1.40E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 9.43E-18 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 2.73E-21 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 1.16E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010015339 | NA | 2.31E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |