RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1009983410:

Variant ID: vg1009983410 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9983410
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAAAAACCTTCTTTTGACTAAGATTCTTTTATTCAAATTTAGTTTGAAAACTCTTTCTATTTTTTTATGAATTATGGTCCAAGAAACCTTCCCATA[T/C]
TGTCCTAGAACCTAAAACAAAGTAATTCCAATTTTATTGGAATTAATTGTTAGCCCATTCTTTGATCTTAAACCCATCCTTTGATTCTCGATCTAAATGT

Reverse complement sequence

ACATTTAGATCGAGAATCAAAGGATGGGTTTAAGATCAAAGAATGGGCTAACAATTAATTCCAATAAAATTGGAATTACTTTGTTTTAGGTTCTAGGACA[A/G]
TATGGGAAGGTTTCTTGGACCATAATTCATAAAAAAATAGAAAGAGTTTTCAAACTAAATTTGAATAAAAGAATCTTAGTCAAAAGAAGGTTTTTAAATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	20.00%	0.02%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	40.70%	59.20%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	18.60%	81.40%	0.00%	0.00%	NA
Tropical Japonica	504	64.90%	35.10%	0.00%	0.00%	NA
Japonica Intermediate	241	60.60%	39.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009983410	T -> C	LOC_Os10g19914.1	upstream_gene_variant ; 3680.0bp to feature; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1009983410	T -> C	LOC_Os10g19919.1	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1009983410	T -> C	LOC_Os10g19919.2	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1009983410	T -> C	LOC_Os10g19919.3	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1009983410	T -> C	LOC_Os10g19919.4	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1009983410	T -> C	LOC_Os10g19914-LOC_Os10g19919	intergenic_region ; MODIFIER	silent_mutation	Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009983410	NA	4.83E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	2.79E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	1.56E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	1.35E-06	1.12E-10	mr1624	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	8.83E-06	3.78E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	6.15E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	3.53E-17	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	4.91E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	8.02E-07	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410	NA	5.63E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 14 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1009983410:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact