\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009983410:

Variant ID: vg1009983410 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9983410
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAAAACCTTCTTTTGACTAAGATTCTTTTATTCAAATTTAGTTTGAAAACTCTTTCTATTTTTTTATGAATTATGGTCCAAGAAACCTTCCCATA[T/C]
TGTCCTAGAACCTAAAACAAAGTAATTCCAATTTTATTGGAATTAATTGTTAGCCCATTCTTTGATCTTAAACCCATCCTTTGATTCTCGATCTAAATGT

Reverse complement sequence

ACATTTAGATCGAGAATCAAAGGATGGGTTTAAGATCAAAGAATGGGCTAACAATTAATTCCAATAAAATTGGAATTACTTTGTTTTAGGTTCTAGGACA[A/G]
TATGGGAAGGTTTCTTGGACCATAATTCATAAAAAAATAGAAAGAGTTTTCAAACTAAATTTGAATAAAAGAATCTTAGTCAAAAGAAGGTTTTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 20.00% 0.02% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 40.70% 59.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 18.60% 81.40% 0.00% 0.00% NA
Tropical Japonica  504 64.90% 35.10% 0.00% 0.00% NA
Japonica Intermediate  241 60.60% 39.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009983410 T -> C LOC_Os10g19914.1 upstream_gene_variant ; 3680.0bp to feature; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009983410 T -> C LOC_Os10g19919.1 upstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009983410 T -> C LOC_Os10g19919.2 upstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009983410 T -> C LOC_Os10g19919.3 upstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009983410 T -> C LOC_Os10g19919.4 upstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009983410 T -> C LOC_Os10g19914-LOC_Os10g19919 intergenic_region ; MODIFIER silent_mutation Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009983410 NA 4.83E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 2.79E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 1.56E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 1.35E-06 1.12E-10 mr1624 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 8.83E-06 3.78E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 6.15E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 3.53E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 4.91E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 8.02E-07 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 5.63E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 4.82E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 2.87E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 5.71E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009983410 NA 1.40E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251