| Variant ID: vg1009948618 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9948618 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.25, others allele: 0.00, population size: 218. )
GCCAGTGGAATTCTGATCAGGTTTACCGATTTTCATATAGGGAAAGAGCATGCAGAATTTTCCATACCATCCATGTGATTAAAATGGTTGCATCAAGCGA[A/T]
TTGATTCCTAACTGAACTTATGCAAGTATAACTCTGATTAGGAATTGAAATATGCAAAAAACGTATAGTTGGTACGAAACAAGGGAGTTATTTACTTGCA
TGCAAGTAAATAACTCCCTTGTTTCGTACCAACTATACGTTTTTTGCATATTTCAATTCCTAATCAGAGTTATACTTGCATAAGTTCAGTTAGGAATCAA[T/A]
TCGCTTGATGCAACCATTTTAATCACATGGATGGTATGGAAAATTCTGCATGCTCTTTCCCTATATGAAAATCGGTAAACCTGATCAGAATTCCACTGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 32.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 28.80% | 71.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.00% | 87.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 51.40% | 48.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 64.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009948618 | A -> T | LOC_Os10g19894.1 | upstream_gene_variant ; 1405.0bp to feature; MODIFIER | silent_mutation | Average:49.249; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg1009948618 | A -> T | LOC_Os10g19894-LOC_Os10g19898 | intergenic_region ; MODIFIER | silent_mutation | Average:49.249; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009948618 | NA | 4.25E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 7.20E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 2.50E-08 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 8.68E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 1.80E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 3.21E-08 | mr1110_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 4.41E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 3.26E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 8.06E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009948618 | NA | 1.03E-18 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/