Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009946077:

Variant ID: vg1009946077 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9946077
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATAAGCCGCGCTGTCGCCTTCTCGCAAAGCACGCAAAAACAATCGAAGGTTTGCCTCCTCCTCTATACTACGCTATTGCTCGTTGGCATGCACTGA[C/T]
AACCCGGAGAGCAGGTCTCCAGAACCTTCGCCTTCAACGCCCTACATCGGGAGAAGGCACTCATAAGGTTTTTGGAAGTGCTTTGCTGGATTGCTGGCTT

Reverse complement sequence

AAGCCAGCAATCCAGCAAAGCACTTCCAAAAACCTTATGAGTGCCTTCTCCCGATGTAGGGCGTTGAAGGCGAAGGTTCTGGAGACCTGCTCTCCGGGTT[G/A]
TCAGTGCATGCCAACGAGCAATAGCGTAGTATAGAGGAGGAGGCAAACCTTCGATTGTTTTTGCGTGCTTTGCGAGAAGGCGACAGCGCGGCTTATATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.10% 0.23% 0.28% NA
All Indica  2759 82.10% 17.40% 0.18% 0.40% NA
All Japonica  1512 68.10% 31.50% 0.26% 0.07% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 89.90% 9.50% 0.00% 0.65% NA
Indica III  913 69.20% 29.90% 0.55% 0.33% NA
Indica Intermediate  786 80.40% 19.00% 0.00% 0.64% NA
Temperate Japonica  767 88.90% 10.70% 0.39% 0.00% NA
Tropical Japonica  504 38.70% 60.90% 0.20% 0.20% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009946077 C -> T LOC_Os10g19892.1 upstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:55.455; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1009946077 C -> T LOC_Os10g19894.1 downstream_gene_variant ; 632.0bp to feature; MODIFIER silent_mutation Average:55.455; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1009946077 C -> T LOC_Os10g19892-LOC_Os10g19894 intergenic_region ; MODIFIER silent_mutation Average:55.455; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1009946077 C -> DEL N N silent_mutation Average:55.455; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009946077 NA 1.00E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.46E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 5.25E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 3.46E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 4.66E-06 9.52E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 3.71E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.56E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.36E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.57E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 4.18E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 4.39E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 5.02E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.11E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.80E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.99E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 4.01E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 4.60E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 3.54E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 6.57E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.50E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 4.31E-06 1.19E-13 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.62E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 4.43E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.21E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 4.67E-06 NA mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 6.13E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.00E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 8.81E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.43E-12 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.52E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 7.10E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.76E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 1.59E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.00E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 2.72E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009946077 NA 5.15E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251