\
| Variant ID: vg1009939190 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9939190 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )
AGTTCAGAAGGTTTTTTGAAGAAGCAAGGCAAGTCACACATTCCCCTTGAGCATGTTAAACCTAATTTACAAATGTTTTACTGTTTGCAAATAAAATTGC[T/A]
TGTTTTGCTAATTACATGGGATTATGGTATTACCTATCTACTCGATTGTGCCGTGTTTACTTGTGATCCGTCCTTTGTCAAACTTTGGGTGATAATTTGA
TCAAATTATCACCCAAAGTTTGACAAAGGACGGATCACAAGTAAACACGGCACAATCGAGTAGATAGGTAATACCATAATCCCATGTAATTAGCAAAACA[A/T]
GCAATTTTATTTGCAAACAGTAAAACATTTGTAAATTAGGTTTAACATGCTCAAGGGGAATGTGTGACTTGCCTTGCTTCTTCAAAAAACCTTCTGAACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 22.50% | 8.17% | 10.52% | NA |
| All Indica | 2759 | 67.80% | 1.20% | 13.37% | 17.62% | NA |
| All Japonica | 1512 | 32.00% | 66.60% | 0.73% | 0.66% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.00% | 0.30% | 7.39% | 7.23% | NA |
| Indica II | 465 | 65.60% | 0.90% | 12.90% | 20.65% | NA |
| Indica III | 913 | 55.00% | 2.00% | 18.07% | 24.97% | NA |
| Indica Intermediate | 786 | 70.90% | 1.30% | 12.72% | 15.14% | NA |
| Temperate Japonica | 767 | 16.30% | 81.40% | 1.17% | 1.17% | NA |
| Tropical Japonica | 504 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.90% | 63.90% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 25.60% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009939190 | T -> A | LOC_Os10g19890.1 | downstream_gene_variant ; 967.0bp to feature; MODIFIER | silent_mutation | Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg1009939190 | T -> A | LOC_Os10g19892.1 | downstream_gene_variant ; 2088.0bp to feature; MODIFIER | silent_mutation | Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg1009939190 | T -> A | LOC_Os10g19890-LOC_Os10g19892 | intergenic_region ; MODIFIER | silent_mutation | Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg1009939190 | T -> DEL | N | N | silent_mutation | Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009939190 | NA | 2.87E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009939190 | NA | 2.20E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009939190 | 5.37E-10 | 5.93E-23 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009939190 | NA | 9.27E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009939190 | NA | 6.38E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009939190 | 6.13E-08 | 1.27E-33 | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |