\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009939190:

Variant ID: vg1009939190 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9939190
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTCAGAAGGTTTTTTGAAGAAGCAAGGCAAGTCACACATTCCCCTTGAGCATGTTAAACCTAATTTACAAATGTTTTACTGTTTGCAAATAAAATTGC[T/A]
TGTTTTGCTAATTACATGGGATTATGGTATTACCTATCTACTCGATTGTGCCGTGTTTACTTGTGATCCGTCCTTTGTCAAACTTTGGGTGATAATTTGA

Reverse complement sequence

TCAAATTATCACCCAAAGTTTGACAAAGGACGGATCACAAGTAAACACGGCACAATCGAGTAGATAGGTAATACCATAATCCCATGTAATTAGCAAAACA[A/T]
GCAATTTTATTTGCAAACAGTAAAACATTTGTAAATTAGGTTTAACATGCTCAAGGGGAATGTGTGACTTGCCTTGCTTCTTCAAAAAACCTTCTGAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 22.50% 8.17% 10.52% NA
All Indica  2759 67.80% 1.20% 13.37% 17.62% NA
All Japonica  1512 32.00% 66.60% 0.73% 0.66% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.00% 0.30% 7.39% 7.23% NA
Indica II  465 65.60% 0.90% 12.90% 20.65% NA
Indica III  913 55.00% 2.00% 18.07% 24.97% NA
Indica Intermediate  786 70.90% 1.30% 12.72% 15.14% NA
Temperate Japonica  767 16.30% 81.40% 1.17% 1.17% NA
Tropical Japonica  504 54.60% 45.40% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 63.90% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 25.60% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009939190 T -> A LOC_Os10g19890.1 downstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg1009939190 T -> A LOC_Os10g19892.1 downstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg1009939190 T -> A LOC_Os10g19890-LOC_Os10g19892 intergenic_region ; MODIFIER silent_mutation Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg1009939190 T -> DEL N N silent_mutation Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009939190 NA 2.87E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190 NA 2.20E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190 5.37E-10 5.93E-23 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190 NA 9.27E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190 NA 6.38E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190 6.13E-08 1.27E-33 mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251