Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009939190:

Variant ID: vg1009939190 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9939190
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTCAGAAGGTTTTTTGAAGAAGCAAGGCAAGTCACACATTCCCCTTGAGCATGTTAAACCTAATTTACAAATGTTTTACTGTTTGCAAATAAAATTGC[T/A]
TGTTTTGCTAATTACATGGGATTATGGTATTACCTATCTACTCGATTGTGCCGTGTTTACTTGTGATCCGTCCTTTGTCAAACTTTGGGTGATAATTTGA

Reverse complement sequence

TCAAATTATCACCCAAAGTTTGACAAAGGACGGATCACAAGTAAACACGGCACAATCGAGTAGATAGGTAATACCATAATCCCATGTAATTAGCAAAACA[A/T]
GCAATTTTATTTGCAAACAGTAAAACATTTGTAAATTAGGTTTAACATGCTCAAGGGGAATGTGTGACTTGCCTTGCTTCTTCAAAAAACCTTCTGAACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	22.50%	8.17%	10.52%	NA
All Indica	2759	67.80%	1.20%	13.37%	17.62%	NA
All Japonica	1512	32.00%	66.60%	0.73%	0.66%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.00%	0.30%	7.39%	7.23%	NA
Indica II	465	65.60%	0.90%	12.90%	20.65%	NA
Indica III	913	55.00%	2.00%	18.07%	24.97%	NA
Indica Intermediate	786	70.90%	1.30%	12.72%	15.14%	NA
Temperate Japonica	767	16.30%	81.40%	1.17%	1.17%	NA
Tropical Japonica	504	54.60%	45.40%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	63.90%	0.83%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	25.60%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009939190	T -> A	LOC_Os10g19890.1	downstream_gene_variant ; 967.0bp to feature; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1009939190	T -> A	LOC_Os10g19892.1	downstream_gene_variant ; 2088.0bp to feature; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1009939190	T -> A	LOC_Os10g19890-LOC_Os10g19892	intergenic_region ; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1009939190	T -> DEL	N	N	silent_mutation	Average:45.776; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009939190	NA	2.87E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190	NA	2.20E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190	5.37E-10	5.93E-23	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190	NA	9.27E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190	NA	6.38E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009939190	6.13E-08	1.27E-33	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251