\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009935788:

Variant ID: vg1009935788 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9935788
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTTTCTGCCACCTTTGGTGGTTGTGTTTTAGAGACAATTGTCTATGCCTTCCTTCTACAATCTACTGTCTTGCACCTGAATGTATTCCTAGAGGCGT[C/T]
GTCTTTTGCTTATGTCTCAGAAATCTGTTTTCATCCTGAACTGGAATGTATGTGGGCTCAACAACCCGGCGGAGAAGGATAATGTTAAATTGCTAGTAGA

Reverse complement sequence

TCTACTAGCAATTTAACATTATCCTTCTCCGCCGGGTTGTTGAGCCCACATACATTCCAGTTCAGGATGAAAACAGATTTCTGAGACATAAGCAAAAGAC[G/A]
ACGCCTCTAGGAATACATTCAGGTGCAAGACAGTAGATTGTAGAAGGAAGGCATAGACAATTGTCTCTAAAACACAACCACCAAAGGTGGCAGAAACACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.10% 0.19% 0.44% NA
All Indica  2759 93.80% 5.90% 0.29% 0.04% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.13% NA
Aus  269 14.90% 80.30% 0.00% 4.83% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 94.40% 5.20% 0.43% 0.00% NA
Indica III  913 93.80% 6.00% 0.22% 0.00% NA
Indica Intermediate  786 89.90% 9.50% 0.38% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 92.20% 3.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009935788 C -> T LOC_Os10g19880.1 upstream_gene_variant ; 4317.0bp to feature; MODIFIER silent_mutation Average:55.39; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1009935788 C -> T LOC_Os10g19890.1 intron_variant ; MODIFIER silent_mutation Average:55.39; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1009935788 C -> DEL N N silent_mutation Average:55.39; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009935788 2.15E-06 NA mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 6.94E-06 NA mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 6.09E-07 2.85E-09 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.56E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.80E-25 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 8.93E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 2.88E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 4.09E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 2.25E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 4.19E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.83E-21 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.61E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.33E-11 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 1.11E-14 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 3.57E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 3.52E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009935788 NA 6.92E-15 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251