\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009912343:

Variant ID: vg1009912343 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9912343
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTCATGGGACATGAACTTTAAAATGCAGGCTGCTGGTGAGGAAGCGAAGTCAGTAGAAATATTAAAGCGCGACAAACTGATAGAATCATTAAGTGCC[A/G,T]
AATGTGCTGCTGCCAAGTCGGCTGCTCAAAGCGAACACGACAAAAATCTGCTACTCCAGAGGCAGTTGGATGATTCATTGAGAGAGATAACTATGTTGCG

Reverse complement sequence

CGCAACATAGTTATCTCTCTCAATGAATCATCCAACTGCCTCTGGAGTAGCAGATTTTTGTCGTGTTCGCTTTGAGCAGCCGACTTGGCAGCAGCACATT[T/C,A]
GGCACTTAATGATTCTATCAGTTTGTCGCGCTTTAATATTTCTACTGACTTCGCTTCCTCACCAGCAGCCTGCATTTTAAAGTTCATGTCCCATGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 16.90% 2.79% 3.77% T: 0.04%
All Indica  2759 98.70% 1.20% 0.04% 0.11% NA
All Japonica  1512 30.80% 49.30% 8.40% 11.38% T: 0.13%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 97.80% 2.10% 0.00% 0.11% NA
Indica Intermediate  786 98.70% 1.00% 0.00% 0.25% NA
Temperate Japonica  767 13.70% 60.20% 10.69% 15.38% NA
Tropical Japonica  504 54.60% 35.10% 4.96% 4.96% T: 0.40%
Japonica Intermediate  241 35.30% 44.40% 8.30% 12.03% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 20.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009912343 A -> G LOC_Os10g19860.1 N nonsynonymous_codon ; K399E Average:47.931; most accessible tissue: Zhenshan97 young leaf, score: 61.386 benign -0.917 TOLERATED 0.85
vg1009912343 A -> T LOC_Os10g19860.1 stop_gained ; p.Lys399*; HIGH stop_gained Average:47.931; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1009912343 A -> DEL LOC_Os10g19860.1 N frameshift_variant Average:47.931; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009912343 NA 3.59E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 NA 4.63E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 NA 6.51E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 3.86E-06 6.32E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 1.38E-06 NA mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 NA 2.10E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 NA 2.41E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009912343 NA 9.29E-30 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251