\
| Variant ID: vg1009899148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9899148 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAACATCGATGACTGTGGACAATTATCAACATATTTTTAGTTAGGAAAAAGTACGAATTACCCCCCTGAACTATCGCGGTCGTCCAAATTACCCCCCTGA[G/A]
CCACAAAACCGGACATTCTTCACCCCCAACTATGCAAACCGGACGAATTACCCCCCTCGACCCAATCCGCGGTGGTTTTGGTCTACGTGGCGTACGCGTG
CACGCGTACGCCACGTAGACCAAAACCACCGCGGATTGGGTCGAGGGGGGTAATTCGTCCGGTTTGCATAGTTGGGGGTGAAGAATGTCCGGTTTTGTGG[C/T]
TCAGGGGGGTAATTTGGACGACCGCGATAGTTCAGGGGGGTAATTCGTACTTTTTCCTAACTAAAAATATGTTGATAATTGTCCACAGTCATCGATGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 22.90% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 28.80% | 67.60% | 3.57% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.80% | 83.20% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009899148 | G -> A | LOC_Os10g19850.1 | upstream_gene_variant ; 1851.0bp to feature; MODIFIER | silent_mutation | Average:63.962; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| vg1009899148 | G -> A | LOC_Os10g19850-LOC_Os10g19860 | intergenic_region ; MODIFIER | silent_mutation | Average:63.962; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009899148 | NA | 1.19E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | NA | 1.20E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | 2.91E-11 | 2.18E-24 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | NA | 2.75E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | NA | 6.16E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | NA | 1.58E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009899148 | 1.23E-06 | 5.22E-32 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |