\
| Variant ID: vg1009864134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9864134 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )
GTCCGTGACGTGATGAGTTACCCAGCCACTCGCTTGGTAATTGACCTATGACAAAACAGTGTAATTCCAACCATGGTGAGAAGAGAGATCAACCATGTTT[G/A]
TAACTATTCTTTGTTTTATCTGTTATAAACATGAATGATGCTTTATAATGGGAACAAAATCCATTGTTCTCCTCTAGGCGCTATGTAACTTACATTCATA
TATGAATGTAAGTTACATAGCGCCTAGAGGAGAACAATGGATTTTGTTCCCATTATAAAGCATCATTCATGTTTATAACAGATAAAACAAAGAATAGTTA[C/T]
AAACATGGTTGATCTCTCTTCTCACCATGGTTGGAATTACACTGTTTTGTCATAGGTCAATTACCAAGCGAGTGGCTGGGTAACTCATCACGTCACGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.10% | 0.49% | 0.21% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 61.80% | 36.10% | 1.52% | 0.53% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 40.80% | 55.50% | 3.00% | 0.65% | NA |
| Tropical Japonica | 504 | 92.10% | 7.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 65.60% | 33.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009864134 | G -> A | LOC_Os10g19330.1 | upstream_gene_variant ; 3862.0bp to feature; MODIFIER | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1009864134 | G -> A | LOC_Os10g19331.1 | downstream_gene_variant ; 1776.0bp to feature; MODIFIER | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1009864134 | G -> A | LOC_Os10g19331.2 | downstream_gene_variant ; 3049.0bp to feature; MODIFIER | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1009864134 | G -> A | LOC_Os10g19334.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1009864134 | G -> A | LOC_Os10g19334.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1009864134 | G -> DEL | N | N | silent_mutation | Average:43.597; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009864134 | 3.58E-06 | 1.01E-19 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 2.21E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 3.51E-06 | mr1865 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | 1.96E-06 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 1.63E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | 4.59E-07 | 1.14E-26 | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 1.23E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 7.59E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 2.76E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | 1.58E-06 | 2.71E-30 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009864134 | NA | 1.01E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |