\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009832100:

Variant ID: vg1009832100 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9832100
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACAACGACAAGTAGGCTCATATTTTCAATTACATCTGCTCCTGGAATAGGACCATTTTCTTTTTAAGCTCTGGGTAGTTTAGGCTAATTAAAAAAACT[C/A]
AAACATGTGAATAAATGGAAATTCTCTGTTCATTACCAAATTTTCTTTTGAATTTACTTGATATTATGTTGTATTAGACTTCACATATCTACCTATTATA

Reverse complement sequence

TATAATAGGTAGATATGTGAAGTCTAATACAACATAATATCAAGTAAATTCAAAAGAAAATTTGGTAATGAACAGAGAATTTCCATTTATTCACATGTTT[G/T]
AGTTTTTTTAATTAGCCTAAACTACCCAGAGCTTAAAAAGAAAATGGTCCTATTCCAGGAGCAGATGTAATTGAAAATATGAGCCTACTTGTCGTTGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 1.00% 0.06% 0.00% NA
All Indica  2759 98.30% 1.60% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.10% 6.60% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009832100 C -> A LOC_Os10g19300.1 downstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:54.4; most accessible tissue: Zhenshan97 flower, score: 85.141 N N N N
vg1009832100 C -> A LOC_Os10g19300-LOC_Os10g19310 intergenic_region ; MODIFIER silent_mutation Average:54.4; most accessible tissue: Zhenshan97 flower, score: 85.141 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009832100 NA 1.92E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 8.36E-07 2.84E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 2.86E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 7.42E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 2.29E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 9.81E-09 mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 1.24E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 8.93E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 9.99E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009832100 NA 1.08E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251