Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009709699:

Variant ID: vg1009709699 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9709699
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATACTATTCATATGAAAACAAATACGTACATATATATGCGAATGTGCCATTAATAAATTTTCTATATATGCTTTCAAGCCACCAACTGGAACCCTAT[C/A]
AACGCTCTTGAGTCACCAAGTAGTAGCACTATAATAAATAAAATAAATCCGACCATCGATTTTCATTTAAATCGGGTGAACCATTGTTTTAGAACGTTAA

Reverse complement sequence

TTAACGTTCTAAAACAATGGTTCACCCGATTTAAATGAAAATCGATGGTCGGATTTATTTTATTTATTATAGTGCTACTACTTGGTGACTCAAGAGCGTT[G/T]
ATAGGGTTCCAGTTGGTGGCTTGAAAGCATATATAGAAAATTTATTAATGGCACATTCGCATATATATGTACGTATTTGTTTTCATATGAATAGTATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	13.20%	0.72%	46.49%	NA
All Indica	2759	26.20%	21.90%	0.69%	51.25%	NA
All Japonica	1512	63.70%	0.50%	0.73%	35.12%	NA
Aus	269	23.40%	2.20%	1.12%	73.23%	NA
Indica I	595	43.50%	3.50%	0.50%	52.44%	NA
Indica II	465	8.40%	64.70%	0.65%	26.24%	NA
Indica III	913	24.50%	7.60%	0.88%	67.03%	NA
Indica Intermediate	786	25.40%	27.10%	0.64%	46.82%	NA
Temperate Japonica	767	90.70%	0.30%	0.78%	8.21%	NA
Tropical Japonica	504	21.40%	0.80%	0.60%	77.18%	NA
Japonica Intermediate	241	66.00%	0.40%	0.83%	32.78%	NA
VI/Aromatic	96	78.10%	0.00%	0.00%	21.88%	NA
Intermediate	90	51.10%	10.00%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009709699	C -> A	LOC_Os10g19064.1	downstream_gene_variant ; 3056.0bp to feature; MODIFIER	silent_mutation	Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1009709699	C -> A	LOC_Os10g19050-LOC_Os10g19064	intergenic_region ; MODIFIER	silent_mutation	Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1009709699	C -> DEL	N	N	silent_mutation	Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009709699	3.35E-06	6.27E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.10E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.91E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.28E-15	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.74E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.76E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	9.15E-07	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.40E-14	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	5.39E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.27E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.04E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	1.30E-06	2.48E-13	mr1114_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	2.05E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	2.03E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	8.48E-06	8.63E-10	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.36E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.98E-23	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	5.88E-10	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.78E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.46E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	7.88E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.05E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	1.03E-10	mr1609_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	5.44E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	7.69E-24	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	2.18E-13	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699	NA	6.10E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251