\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009709699:

Variant ID: vg1009709699 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9709699
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATACTATTCATATGAAAACAAATACGTACATATATATGCGAATGTGCCATTAATAAATTTTCTATATATGCTTTCAAGCCACCAACTGGAACCCTAT[C/A]
AACGCTCTTGAGTCACCAAGTAGTAGCACTATAATAAATAAAATAAATCCGACCATCGATTTTCATTTAAATCGGGTGAACCATTGTTTTAGAACGTTAA

Reverse complement sequence

TTAACGTTCTAAAACAATGGTTCACCCGATTTAAATGAAAATCGATGGTCGGATTTATTTTATTTATTATAGTGCTACTACTTGGTGACTCAAGAGCGTT[G/T]
ATAGGGTTCCAGTTGGTGGCTTGAAAGCATATATAGAAAATTTATTAATGGCACATTCGCATATATATGTACGTATTTGTTTTCATATGAATAGTATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 13.20% 0.72% 46.49% NA
All Indica  2759 26.20% 21.90% 0.69% 51.25% NA
All Japonica  1512 63.70% 0.50% 0.73% 35.12% NA
Aus  269 23.40% 2.20% 1.12% 73.23% NA
Indica I  595 43.50% 3.50% 0.50% 52.44% NA
Indica II  465 8.40% 64.70% 0.65% 26.24% NA
Indica III  913 24.50% 7.60% 0.88% 67.03% NA
Indica Intermediate  786 25.40% 27.10% 0.64% 46.82% NA
Temperate Japonica  767 90.70% 0.30% 0.78% 8.21% NA
Tropical Japonica  504 21.40% 0.80% 0.60% 77.18% NA
Japonica Intermediate  241 66.00% 0.40% 0.83% 32.78% NA
VI/Aromatic  96 78.10% 0.00% 0.00% 21.88% NA
Intermediate  90 51.10% 10.00% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009709699 C -> A LOC_Os10g19064.1 downstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1009709699 C -> A LOC_Os10g19050-LOC_Os10g19064 intergenic_region ; MODIFIER silent_mutation Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1009709699 C -> DEL N N silent_mutation Average:38.896; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009709699 3.35E-06 6.27E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.10E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.91E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.28E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.74E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.76E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 9.15E-07 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.40E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 5.39E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.27E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.04E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 1.30E-06 2.48E-13 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 2.05E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 2.03E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 8.48E-06 8.63E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.36E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.98E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 5.88E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.78E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.46E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 7.88E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.05E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 1.03E-10 mr1609_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 5.44E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 7.69E-24 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 2.18E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709699 NA 6.10E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251