Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009709662:

Variant ID: vg1009709662 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9709662
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAAAACGTTCGTACGTACCATAAAAAATATCTAAAAAAATACTATTCATATGAAAACAAATACGTACATATATATGCGAATGTGCCATTAATAAATTT[T/C]
CTATATATGCTTTCAAGCCACCAACTGGAACCCTATCAACGCTCTTGAGTCACCAAGTAGTAGCACTATAATAAATAAAATAAATCCGACCATCGATTTT

Reverse complement sequence

AAAATCGATGGTCGGATTTATTTTATTTATTATAGTGCTACTACTTGGTGACTCAAGAGCGTTGATAGGGTTCCAGTTGGTGGCTTGAAAGCATATATAG[A/G]
AAATTTATTAATGGCACATTCGCATATATATGTACGTATTTGTTTTCATATGAATAGTATTTTTTTAGATATTTTTTATGGTACGTACGAACGTTTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	13.60%	0.80%	46.57%	NA
All Indica	2759	25.60%	22.30%	0.72%	51.40%	NA
All Japonica	1512	63.70%	0.60%	0.99%	34.72%	NA
Aus	269	22.30%	2.20%	0.00%	75.46%	NA
Indica I	595	43.70%	3.90%	0.67%	51.76%	NA
Indica II	465	8.00%	65.40%	0.00%	26.67%	NA
Indica III	913	23.50%	8.00%	1.10%	67.36%	NA
Indica Intermediate	786	24.70%	27.40%	0.76%	47.20%	NA
Temperate Japonica	767	91.00%	0.40%	1.04%	7.56%	NA
Tropical Japonica	504	21.20%	0.80%	0.99%	76.98%	NA
Japonica Intermediate	241	65.60%	0.80%	0.83%	32.78%	NA
VI/Aromatic	96	72.90%	2.10%	3.12%	21.88%	NA
Intermediate	90	52.20%	10.00%	0.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009709662	T -> C	LOC_Os10g19064.1	downstream_gene_variant ; 3093.0bp to feature; MODIFIER	silent_mutation	Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1009709662	T -> C	LOC_Os10g19050-LOC_Os10g19064	intergenic_region ; MODIFIER	silent_mutation	Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1009709662	T -> DEL	N	N	silent_mutation	Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009709662	3.22E-06	5.96E-09	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	3.22E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	6.57E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	4.42E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	8.89E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.58E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	6.71E-16	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	3.61E-07	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.68E-14	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.64E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	9.09E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	7.79E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	1.36E-06	3.04E-13	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.57E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.98E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.13E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.09E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.45E-23	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	4.62E-10	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	2.45E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	2.60E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	8.38E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	9.30E-10	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	7.50E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.32E-10	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	5.49E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	1.64E-24	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	5.52E-14	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662	NA	6.18E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251