\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009709662:

Variant ID: vg1009709662 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9709662
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAACGTTCGTACGTACCATAAAAAATATCTAAAAAAATACTATTCATATGAAAACAAATACGTACATATATATGCGAATGTGCCATTAATAAATTT[T/C]
CTATATATGCTTTCAAGCCACCAACTGGAACCCTATCAACGCTCTTGAGTCACCAAGTAGTAGCACTATAATAAATAAAATAAATCCGACCATCGATTTT

Reverse complement sequence

AAAATCGATGGTCGGATTTATTTTATTTATTATAGTGCTACTACTTGGTGACTCAAGAGCGTTGATAGGGTTCCAGTTGGTGGCTTGAAAGCATATATAG[A/G]
AAATTTATTAATGGCACATTCGCATATATATGTACGTATTTGTTTTCATATGAATAGTATTTTTTTAGATATTTTTTATGGTACGTACGAACGTTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 13.60% 0.80% 46.57% NA
All Indica  2759 25.60% 22.30% 0.72% 51.40% NA
All Japonica  1512 63.70% 0.60% 0.99% 34.72% NA
Aus  269 22.30% 2.20% 0.00% 75.46% NA
Indica I  595 43.70% 3.90% 0.67% 51.76% NA
Indica II  465 8.00% 65.40% 0.00% 26.67% NA
Indica III  913 23.50% 8.00% 1.10% 67.36% NA
Indica Intermediate  786 24.70% 27.40% 0.76% 47.20% NA
Temperate Japonica  767 91.00% 0.40% 1.04% 7.56% NA
Tropical Japonica  504 21.20% 0.80% 0.99% 76.98% NA
Japonica Intermediate  241 65.60% 0.80% 0.83% 32.78% NA
VI/Aromatic  96 72.90% 2.10% 3.12% 21.88% NA
Intermediate  90 52.20% 10.00% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009709662 T -> C LOC_Os10g19064.1 downstream_gene_variant ; 3093.0bp to feature; MODIFIER silent_mutation Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1009709662 T -> C LOC_Os10g19050-LOC_Os10g19064 intergenic_region ; MODIFIER silent_mutation Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1009709662 T -> DEL N N silent_mutation Average:34.479; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009709662 3.22E-06 5.96E-09 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 3.22E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 6.57E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 4.42E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 8.89E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.58E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 6.71E-16 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 3.61E-07 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.68E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.64E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 9.09E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 7.79E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 1.36E-06 3.04E-13 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.57E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.98E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.13E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.09E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.45E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 4.62E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 2.45E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 2.60E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 8.38E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 9.30E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 7.50E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.32E-10 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 5.49E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 1.64E-24 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 5.52E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009709662 NA 6.18E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251