Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009704100:

Variant ID: vg1009704100 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9704100
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGCGTCGCGGAGAGGGAGGAGAAGGAGGCGAGGCAGCGCGAGTAGTACTCGAGGAGGCGCGCGAGGGCTGTTCGGGAAAGGAGGACGAATCGGTCCGC[A/G]
CGAGTAGTACTCAATGTGACGATTCCTTTCCGTGGGGCCCACCGGCTGTAGGCTTGGTACCCTGACTATGGGTGCTTGCACTGTGGGAAGGGTGTCCTTG

Reverse complement sequence

CAAGGACACCCTTCCCACAGTGCAAGCACCCATAGTCAGGGTACCAAGCCTACAGCCGGTGGGCCCCACGGAAAGGAATCGTCACATTGAGTACTACTCG[T/C]
GCGGACCGATTCGTCCTCCTTTCCCGAACAGCCCTCGCGCGCCTCCTCGAGTACTACTCGCGCTGCCTCGCCTCCTTCTCCTCCCTCTCCGCGACGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	38.50%	0.21%	0.00%	NA
All Indica	2759	60.30%	39.40%	0.33%	0.00%	NA
All Japonica	1512	57.80%	42.20%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	74.80%	24.50%	0.67%	0.00%	NA
Indica II	465	41.10%	58.10%	0.86%	0.00%	NA
Indica III	913	63.90%	36.00%	0.11%	0.00%	NA
Indica Intermediate	786	56.50%	43.50%	0.00%	0.00%	NA
Temperate Japonica	767	60.10%	39.90%	0.00%	0.00%	NA
Tropical Japonica	504	50.20%	49.80%	0.00%	0.00%	NA
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009704100	A -> G	LOC_Os10g19050.1	upstream_gene_variant ; 1782.0bp to feature; MODIFIER	silent_mutation	Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1009704100	A -> G	LOC_Os10g19050-LOC_Os10g19064	intergenic_region ; MODIFIER	silent_mutation	Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009704100	NA	1.11E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	2.33E-06	1.62E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	4.57E-06	6.18E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	4.34E-06	8.01E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	3.48E-06	NA	mr1436	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	1.01E-09	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	2.40E-09	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	1.39E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	7.44E-07	2.57E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	2.36E-06	3.93E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	4.81E-11	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	1.53E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100	NA	7.33E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251