\
| Variant ID: vg1009704100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9704100 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 89. )
TCGGCGTCGCGGAGAGGGAGGAGAAGGAGGCGAGGCAGCGCGAGTAGTACTCGAGGAGGCGCGCGAGGGCTGTTCGGGAAAGGAGGACGAATCGGTCCGC[A/G]
CGAGTAGTACTCAATGTGACGATTCCTTTCCGTGGGGCCCACCGGCTGTAGGCTTGGTACCCTGACTATGGGTGCTTGCACTGTGGGAAGGGTGTCCTTG
CAAGGACACCCTTCCCACAGTGCAAGCACCCATAGTCAGGGTACCAAGCCTACAGCCGGTGGGCCCCACGGAAAGGAATCGTCACATTGAGTACTACTCG[T/C]
GCGGACCGATTCGTCCTCCTTTCCCGAACAGCCCTCGCGCGCCTCCTCGAGTACTACTCGCGCTGCCTCGCCTCCTTCTCCTCCCTCTCCGCGACGCCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 38.50% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 60.30% | 39.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 24.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 41.10% | 58.10% | 0.86% | 0.00% | NA |
| Indica III | 913 | 63.90% | 36.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 60.10% | 39.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009704100 | A -> G | LOC_Os10g19050.1 | upstream_gene_variant ; 1782.0bp to feature; MODIFIER | silent_mutation | Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| vg1009704100 | A -> G | LOC_Os10g19050-LOC_Os10g19064 | intergenic_region ; MODIFIER | silent_mutation | Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009704100 | NA | 1.11E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 2.33E-06 | 1.62E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 4.57E-06 | 6.18E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 4.34E-06 | 8.01E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 3.48E-06 | NA | mr1436 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 1.01E-09 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 2.40E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 1.39E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 7.44E-07 | 2.57E-07 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | 2.36E-06 | 3.93E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 4.81E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 1.53E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009704100 | NA | 7.33E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |