\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009704100:

Variant ID: vg1009704100 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9704100
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGCGTCGCGGAGAGGGAGGAGAAGGAGGCGAGGCAGCGCGAGTAGTACTCGAGGAGGCGCGCGAGGGCTGTTCGGGAAAGGAGGACGAATCGGTCCGC[A/G]
CGAGTAGTACTCAATGTGACGATTCCTTTCCGTGGGGCCCACCGGCTGTAGGCTTGGTACCCTGACTATGGGTGCTTGCACTGTGGGAAGGGTGTCCTTG

Reverse complement sequence

CAAGGACACCCTTCCCACAGTGCAAGCACCCATAGTCAGGGTACCAAGCCTACAGCCGGTGGGCCCCACGGAAAGGAATCGTCACATTGAGTACTACTCG[T/C]
GCGGACCGATTCGTCCTCCTTTCCCGAACAGCCCTCGCGCGCCTCCTCGAGTACTACTCGCGCTGCCTCGCCTCCTTCTCCTCCCTCTCCGCGACGCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.50% 0.21% 0.00% NA
All Indica  2759 60.30% 39.40% 0.33% 0.00% NA
All Japonica  1512 57.80% 42.20% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 74.80% 24.50% 0.67% 0.00% NA
Indica II  465 41.10% 58.10% 0.86% 0.00% NA
Indica III  913 63.90% 36.00% 0.11% 0.00% NA
Indica Intermediate  786 56.50% 43.50% 0.00% 0.00% NA
Temperate Japonica  767 60.10% 39.90% 0.00% 0.00% NA
Tropical Japonica  504 50.20% 49.80% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009704100 A -> G LOC_Os10g19050.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1009704100 A -> G LOC_Os10g19050-LOC_Os10g19064 intergenic_region ; MODIFIER silent_mutation Average:69.038; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009704100 NA 1.11E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 2.33E-06 1.62E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 4.57E-06 6.18E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 4.34E-06 8.01E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 3.48E-06 NA mr1436 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 1.01E-09 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 2.40E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 1.39E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 7.44E-07 2.57E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 2.36E-06 3.93E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 4.81E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 1.53E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009704100 NA 7.33E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251