\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009697437:

Variant ID: vg1009697437 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9697437
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGGAGGTGGCGGAGCACTGGTACCGGCTCTACAAGACGGACAATCAAGGGGTACCACAATCCGGCTCCACCTCGACGCCATTCTGGCAACCACGAAA[A/T]
CCTCACGCTCCAATCTATGCCCTCCGCCTGTGCTCGCTGCATCTCGTGCCACCGTCTCGGCCTCTCGATCGTCATGGCCTGAATTATTCTAATTCTTCGT

Reverse complement sequence

ACGAAGAATTAGAATAATTCAGGCCATGACGATCGAGAGGCCGAGACGGTGGCACGAGATGCAGCGAGCACAGGCGGAGGGCATAGATTGGAGCGTGAGG[T/A]
TTTCGTGGTTGCCAGAATGGCGTCGAGGTGGAGCCGGATTGTGGTACCCCTTGATTGTCCGTCTTGTAGAGCCGGTACCAGTGCTCCGCCACCTCCAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 18.20% 0.38% 8.02% NA
All Indica  2759 69.00% 30.30% 0.14% 0.58% NA
All Japonica  1512 74.60% 1.00% 0.86% 23.54% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 29.90% 69.60% 0.00% 0.50% NA
Indica II  465 84.10% 15.50% 0.22% 0.22% NA
Indica III  913 82.90% 15.90% 0.33% 0.88% NA
Indica Intermediate  786 73.50% 26.00% 0.00% 0.51% NA
Temperate Japonica  767 75.60% 0.90% 0.91% 22.56% NA
Tropical Japonica  504 65.70% 1.00% 1.19% 32.14% NA
Japonica Intermediate  241 90.00% 1.20% 0.00% 8.71% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 8.90% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009697437 A -> T LOC_Os10g19040.1 missense_variant ; p.Phe26Ile; MODERATE nonsynonymous_codon ; F26I Average:70.99; most accessible tissue: Zhenshan97 young leaf, score: 81.841 unknown unknown DELETERIOUS 0.00
vg1009697437 A -> DEL LOC_Os10g19040.1 N frameshift_variant Average:70.99; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009697437 8.00E-06 1.05E-37 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 3.09E-07 8.21E-23 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 1.48E-07 5.02E-16 mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 1.98E-07 3.64E-16 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 3.54E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 7.72E-06 NA mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 3.48E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 7.53E-07 1.33E-20 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 3.90E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 2.68E-06 2.82E-18 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 6.31E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 5.68E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 7.13E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 9.99E-06 3.87E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 2.77E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 3.58E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 8.21E-06 7.20E-40 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 3.25E-06 5.15E-25 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 9.56E-07 6.35E-27 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 1.47E-06 1.04E-22 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 2.05E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 1.15E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 3.84E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009697437 NA 9.08E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251