Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009664258:

Variant ID: vg1009664258 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9664258
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

AATGCGATCCAAAATCGTTTTTCCTTGTGACGGCATTTTGTGTATGAATGATCCTCCAGCGGTTATGTCCAAATAGAATGCAGACTCCTTATCCAAACTC[G/A]
TATGGAAATGTGGGAGAAGCACATACTCGGGTAAGGACAGGGTTGGTCCGGACTGGACTAAATTAGTGAATCTGGACCAAGCTGCACCGATTGATTCGTT

Reverse complement sequence

AACGAATCAATCGGTGCAGCTTGGTCCAGATTCACTAATTTAGTCCAGTCCGGACCAACCCTGTCCTTACCCGAGTATGTGCTTCTCCCACATTTCCATA[C/T]
GAGTTTGGATAAGGAGTCTGCATTCTATTTGGACATAACCGCTGGAGGATCATTCATACACAAAATGCCGTCACAAGGAAAAACGATTTTGGATCGCATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	19.20%	5.76%	17.54%	NA
All Indica	2759	37.40%	25.50%	9.46%	27.65%	NA
All Japonica	1512	83.50%	12.80%	0.26%	3.44%	NA
Aus	269	98.50%	0.00%	0.37%	1.12%	NA
Indica I	595	74.30%	1.80%	1.68%	22.18%	NA
Indica II	465	19.40%	24.50%	18.49%	37.63%	NA
Indica III	913	21.90%	45.10%	9.20%	23.77%	NA
Indica Intermediate	786	38.20%	21.10%	10.31%	30.41%	NA
Temperate Japonica	767	94.90%	4.80%	0.00%	0.26%	NA
Tropical Japonica	504	70.20%	19.80%	0.79%	9.13%	NA
Japonica Intermediate	241	74.70%	23.70%	0.00%	1.66%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	71.10%	13.30%	4.44%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009664258	G -> A	LOC_Os10g18980.1	missense_variant ; p.Thr65Met; MODERATE	nonsynonymous_codon ; T65M	Average:41.027; most accessible tissue: Minghui63 young leaf, score: 65.161	benign	0.786	TOLERATED	0.06
vg1009664258	G -> DEL	LOC_Os10g18980.1	N	frameshift_variant	Average:41.027; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009664258	NA	4.19E-11	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	5.08E-06	4.70E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	1.88E-07	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	6.05E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	4.09E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	7.46E-07	NA	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	9.25E-09	2.28E-11	mr1120	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	4.54E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	9.31E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	7.97E-06	5.93E-18	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	3.65E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	8.64E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	4.02E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	2.00E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	3.07E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	8.38E-09	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	1.13E-10	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	6.39E-08	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	1.53E-13	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	4.34E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	7.57E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	1.59E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	6.31E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	9.70E-16	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	1.84E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009664258	NA	7.35E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251