\
| Variant ID: vg1009652919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9652919 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 90. )
TGACCGTCTTTTGCAGAATATTCTTGATTTATTTGTTTGATGTTTCTTCTTGTCCACTGGTCTGTGGATGGTAAGGAGTAGCCACATTGTGTTTGGCTCC[C/T]
ATTTCTCGTAGGAGGTCTCGGAAGGTTTTATCAATGAAATGAGAACCTCCGTCACTTATGACCATTCTGGGGGTACCAAATCTTGGGAAGATGATTTCTG
CAGAAATCATCTTCCCAAGATTTGGTACCCCCAGAATGGTCATAAGTGACGGAGGTTCTCATTTCATTGATAAAACCTTCCGAGACCTCCTACGAGAAAT[G/A]
GGAGCCAAACACAATGTGGCTACTCCTTACCATCCACAGACCAGTGGACAAGAAGAAACATCAAACAAATAAATCAAGAATATTCTGCAAAAGACGGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 41.90% | 2.77% | 9.42% | NA |
| All Indica | 2759 | 25.00% | 56.20% | 4.35% | 14.46% | NA |
| All Japonica | 1512 | 73.70% | 23.30% | 0.53% | 2.51% | NA |
| Aus | 269 | 87.70% | 11.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 12.80% | 72.30% | 3.03% | 11.93% | NA |
| Indica II | 465 | 35.50% | 40.20% | 5.16% | 19.14% | NA |
| Indica III | 913 | 22.50% | 60.80% | 5.04% | 11.72% | NA |
| Indica Intermediate | 786 | 30.90% | 48.20% | 4.07% | 16.79% | NA |
| Temperate Japonica | 767 | 83.10% | 16.60% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 70.00% | 21.80% | 1.39% | 6.75% | NA |
| Japonica Intermediate | 241 | 51.50% | 47.70% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 31.10% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009652919 | C -> T | LOC_Os10g18960.1 | missense_variant ; p.Met337Ile; MODERATE | nonsynonymous_codon ; M337I | Average:42.697; most accessible tissue: Minghui63 flag leaf, score: 63.692 | benign |
0.376 |
DELETERIOUS | 0.05 |
| vg1009652919 | C -> DEL | LOC_Os10g18960.1 | N | frameshift_variant | Average:42.697; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009652919 | 7.46E-06 | 7.45E-06 | mr1027 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 4.18E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | 3.68E-06 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 3.10E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 2.42E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | 2.00E-07 | 1.29E-12 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | 1.14E-06 | 2.00E-14 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 8.61E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 5.70E-06 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 1.09E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 1.03E-15 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652919 | NA | 8.50E-14 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |