\
| Variant ID: vg1009652418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9652418 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 111. )
ACAGGTATTTTCTTGAGACCATTTAAAACTCCAATTTAGGCTTGGGAAAGAACTTCGGGGTGTGACAGGTTGCCCCGTGCGAAGAGGTGTCGATGACGTC[G/A]
AACGGTCCTTCCCATTTGCTGCGCAGTTTTCCGTGGCCGAAGGGCTTAACTCTGGAGTTGAACAACTGTAATTTGTCTCCTGGTTTGAATTTCTTGATCT
AGATCAAGAAATTCAAACCAGGAGACAAATTACAGTTGTTCAACTCCAGAGTTAAGCCCTTCGGCCACGGAAAACTGCGCAGCAAATGGGAAGGACCGTT[C/T]
GACGTCATCGACACCTCTTCGCACGGGGCAACCTGTCACACCCCGAAGTTCTTTCCCAAGCCTAAATTGGAGTTTTAAATGGTCTCAAGAAAATACCTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 4.40% | 4.04% | 36.78% | NA |
| All Indica | 2759 | 38.10% | 5.70% | 5.11% | 51.11% | NA |
| All Japonica | 1512 | 73.70% | 3.40% | 3.11% | 19.84% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 74.30% | 0.50% | 1.01% | 24.20% | NA |
| Indica II | 465 | 19.80% | 3.90% | 3.44% | 72.90% | NA |
| Indica III | 913 | 23.30% | 11.50% | 7.78% | 57.39% | NA |
| Indica Intermediate | 786 | 38.80% | 3.80% | 6.11% | 51.27% | NA |
| Temperate Japonica | 767 | 83.70% | 1.60% | 1.30% | 13.43% | NA |
| Tropical Japonica | 504 | 69.40% | 3.60% | 5.36% | 21.63% | NA |
| Japonica Intermediate | 241 | 50.60% | 8.70% | 4.15% | 36.51% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 1.10% | 3.33% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009652418 | G -> A | LOC_Os10g18940.1 | upstream_gene_variant ; 4669.0bp to feature; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1009652418 | G -> A | LOC_Os10g18960.1 | downstream_gene_variant ; 429.0bp to feature; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1009652418 | G -> A | LOC_Os10g18940-LOC_Os10g18960 | intergenic_region ; MODIFIER | silent_mutation | Average:26.215; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1009652418 | G -> DEL | N | N | silent_mutation | Average:26.215; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009652418 | NA | 7.83E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.78E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 7.20E-07 | 2.14E-11 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.39E-08 | 2.22E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.78E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 3.29E-10 | 2.27E-13 | mr1116 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 2.87E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.68E-08 | 3.88E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.28E-06 | 5.49E-10 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.87E-06 | 2.21E-08 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.88E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 3.72E-07 | 1.81E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.84E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 4.64E-09 | 4.13E-12 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.64E-07 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 8.43E-09 | 3.78E-23 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 6.45E-07 | 7.56E-14 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.25E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 7.16E-07 | 5.17E-15 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 9.45E-07 | 2.33E-12 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 3.36E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.30E-07 | 5.54E-09 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 6.03E-06 | 1.51E-11 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 5.19E-06 | 3.27E-12 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 2.83E-09 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 7.99E-07 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.25E-08 | 8.16E-21 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 6.97E-09 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.09E-06 | 1.49E-12 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 3.64E-11 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.13E-10 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.54E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 4.28E-06 | 7.22E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.06E-09 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 1.70E-08 | 9.83E-24 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.40E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | 2.51E-06 | 7.83E-19 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 1.31E-12 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 2.29E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009652418 | NA | 3.40E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |