Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009646441:

Variant ID: vg1009646441 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9646441
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAAAGAAAGCTTACCATGATAATCCGGGGTATCTCCCGGCAGTGCTTTGTTTATGGTCACAAGCTTGACCATGGGGACATTGCTCTGCAAGATTAGTG[T/C,A]
CAAACAAATATGAGATTTGCAGTATTTATGATAAATATAAGCATCCACAACCACACTTCTGAACATGTTAGAAATGAGGACCGAGAGGTGGTTGTGGTCC

Reverse complement sequence

GGACCACAACCACCTCTCGGTCCTCATTTCTAACATGTTCAGAAGTGTGGTTGTGGATGCTTATATTTATCATAAATACTGCAAATCTCATATTTGTTTG[A/G,T]
CACTAATCTTGCAGAGCAATGTCCCCATGGTCAAGCTTGTGACCATAAACAAAGCACTGCCGGGAGATACCCCGGATTATCATGGTAAGCTTTCTTTCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.10%	11.80%	35.25%	4.15%	A: 0.61%
All Indica	2759	31.90%	15.60%	50.78%	1.01%	A: 0.69%
All Japonica	1512	68.60%	7.70%	12.30%	10.85%	A: 0.53%
Aus	269	86.60%	1.10%	11.90%	0.00%	A: 0.37%
Indica I	595	6.10%	24.00%	68.40%	0.67%	A: 0.84%
Indica II	465	29.50%	12.30%	56.77%	1.08%	A: 0.43%
Indica III	913	50.20%	11.80%	35.60%	1.75%	A: 0.66%
Indica Intermediate	786	31.70%	15.60%	51.53%	0.38%	A: 0.76%
Temperate Japonica	767	72.10%	3.10%	5.08%	19.69%	NA
Tropical Japonica	504	54.80%	16.10%	25.60%	2.18%	A: 1.39%
Japonica Intermediate	241	86.30%	5.00%	7.47%	0.83%	A: 0.41%
VI/Aromatic	96	77.10%	2.10%	20.83%	0.00%	NA
Intermediate	90	56.70%	7.80%	30.00%	4.44%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009646441	T -> C	LOC_Os10g18940.1	missense_variant ; p.Thr437Ala; MODERATE	nonsynonymous_codon ; T437A	Average:39.341; most accessible tissue: Zhenshan97 panicle, score: 59.59	unknown	unknown	TOLERATED	0.16
vg1009646441	T -> A	LOC_Os10g18940.1	missense_variant ; p.Thr437Ser; MODERATE	nonsynonymous_codon ; T437S	Average:39.341; most accessible tissue: Zhenshan97 panicle, score: 59.59	unknown	unknown	TOLERATED	0.21
vg1009646441	T -> DEL	LOC_Os10g18940.1	N	frameshift_variant	Average:39.341; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009646441	NA	7.96E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.07E-08	1.96E-19	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.46E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.39E-06	8.25E-11	mr1108	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	6.96E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	4.63E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.28E-06	2.89E-09	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.89E-13	9.78E-25	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	9.85E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.55E-06	6.86E-08	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.57E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	5.59E-08	1.73E-18	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	2.60E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	6.74E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.80E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	9.51E-07	4.50E-09	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	6.10E-06	1.72E-10	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.75E-11	2.29E-25	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.71E-08	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	5.76E-06	NA	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	2.22E-06	9.77E-10	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.97E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	6.62E-06	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	2.57E-07	7.84E-13	mr1108_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	2.89E-06	3.98E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	5.03E-07	7.09E-11	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	1.10E-07	1.33E-11	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	1.38E-06	1.91E-09	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	8.81E-11	2.05E-25	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	3.62E-06	4.14E-09	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	5.14E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	1.88E-07	5.28E-13	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	7.86E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	7.59E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	4.91E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.13E-14	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	3.85E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	1.69E-06	1.89E-12	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	2.11E-06	4.85E-11	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	6.96E-07	3.79E-08	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	1.87E-11	1.63E-26	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.47E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	9.44E-08	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	2.99E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	2.25E-06	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	1.74E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	2.16E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	4.20E-06	mr1913_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009646441	NA	9.33E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251