Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009645414:

Variant ID: vg1009645414 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9645414
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGAGCATATGCAAATAGACACAAGAAACATAACCATGTATGATCAAGTCTCATTCAAATGAAGATAAGTATGAGTAAAAGGAATGGTGAACCTTATTT[T/C]
ATCTTTCACATACCTGAGTGTACTTACCTCCAGCATGATGTATATTTTGAAATCTCTAGGCAGTGGCATGGTCACATATGATTGGCGATTTCTCCTCCAT

Reverse complement sequence

ATGGAGGAGAAATCGCCAATCATATGTGACCATGCCACTGCCTAGAGATTTCAAAATATACATCATGCTGGAGGTAAGTACACTCAGGTATGTGAAAGAT[A/G]
AAATAAGGTTCACCATTCCTTTTACTCATACTTATCTTCATTTGAATGAGACTTGATCATACATGGTTATGTTTCTTGTGTCTATTTGCATATGCTCTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	22.30%	1.80%	7.98%	NA
All Indica	2759	62.50%	35.50%	1.63%	0.36%	NA
All Japonica	1512	70.30%	3.60%	2.58%	23.48%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	76.00%	22.90%	1.18%	0.00%	NA
Indica II	465	44.90%	51.40%	3.44%	0.22%	NA
Indica III	913	65.20%	32.70%	1.20%	0.88%	NA
Indica Intermediate	786	59.70%	38.80%	1.40%	0.13%	NA
Temperate Japonica	767	73.30%	0.30%	2.09%	24.38%	NA
Tropical Japonica	504	56.90%	9.70%	3.17%	30.16%	NA
Japonica Intermediate	241	88.80%	1.70%	2.90%	6.64%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	15.60%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009645414	T -> C	LOC_Os10g18940.1	intron_variant ; MODIFIER	silent_mutation	Average:35.779; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1009645414	T -> DEL	N	N	silent_mutation	Average:35.779; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009645414	NA	1.50E-09	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	9.66E-06	3.62E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	6.00E-06	5.33E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	NA	6.81E-10	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	NA	1.69E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	NA	2.58E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	5.70E-06	2.19E-08	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	1.80E-06	7.63E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	7.58E-06	9.72E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	5.28E-06	6.71E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	4.30E-07	6.88E-09	mr1250_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	1.75E-06	1.75E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	NA	5.62E-09	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414	NA	6.06E-08	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251