\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009645414:

Variant ID: vg1009645414 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9645414
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGAGCATATGCAAATAGACACAAGAAACATAACCATGTATGATCAAGTCTCATTCAAATGAAGATAAGTATGAGTAAAAGGAATGGTGAACCTTATTT[T/C]
ATCTTTCACATACCTGAGTGTACTTACCTCCAGCATGATGTATATTTTGAAATCTCTAGGCAGTGGCATGGTCACATATGATTGGCGATTTCTCCTCCAT

Reverse complement sequence

ATGGAGGAGAAATCGCCAATCATATGTGACCATGCCACTGCCTAGAGATTTCAAAATATACATCATGCTGGAGGTAAGTACACTCAGGTATGTGAAAGAT[A/G]
AAATAAGGTTCACCATTCCTTTTACTCATACTTATCTTCATTTGAATGAGACTTGATCATACATGGTTATGTTTCTTGTGTCTATTTGCATATGCTCTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 22.30% 1.80% 7.98% NA
All Indica  2759 62.50% 35.50% 1.63% 0.36% NA
All Japonica  1512 70.30% 3.60% 2.58% 23.48% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 76.00% 22.90% 1.18% 0.00% NA
Indica II  465 44.90% 51.40% 3.44% 0.22% NA
Indica III  913 65.20% 32.70% 1.20% 0.88% NA
Indica Intermediate  786 59.70% 38.80% 1.40% 0.13% NA
Temperate Japonica  767 73.30% 0.30% 2.09% 24.38% NA
Tropical Japonica  504 56.90% 9.70% 3.17% 30.16% NA
Japonica Intermediate  241 88.80% 1.70% 2.90% 6.64% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 15.60% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009645414 T -> C LOC_Os10g18940.1 intron_variant ; MODIFIER silent_mutation Average:35.779; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1009645414 T -> DEL N N silent_mutation Average:35.779; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009645414 NA 1.50E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 9.66E-06 3.62E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 6.00E-06 5.33E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 NA 6.81E-10 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 NA 1.69E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 NA 2.58E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 5.70E-06 2.19E-08 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 1.80E-06 7.63E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 7.58E-06 9.72E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 5.28E-06 6.71E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 4.30E-07 6.88E-09 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 1.75E-06 1.75E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 NA 5.62E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009645414 NA 6.06E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251