\
| Variant ID: vg1009640089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9640089 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 109. )
TTCATTATATGCAGGTATTGACGGTCAAATATTATGATTTAAGGACCGTCAACAACACCACCACACTTAACCTTTGCTCGTCCCGAGTGAAGGCTATGGA[C/A]
TCTACAACAGAATTATGACTTCCTTACTTCCTTACTAATAGTCACGCAAACAAATTATTCAAAGTCATACTTGTATTTGTGGATGTTTGTAGTGTCTACC
GGTAGACACTACAAACATCCACAAATACAAGTATGACTTTGAATAATTTGTTTGCGTGACTATTAGTAAGGAAGTAAGGAAGTCATAATTCTGTTGTAGA[G/T]
TCCATAGCCTTCACTCGGGACGAGCAAAGGTTAAGTGTGGTGGTGTTGTTGACGGTCCTTAAATCATAATATTTGACCGTCAATACCTGCATATAATGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 19.30% | 0.36% | 31.63% | NA |
| All Indica | 2759 | 37.30% | 25.50% | 0.36% | 36.90% | NA |
| All Japonica | 1512 | 57.00% | 13.00% | 0.46% | 29.56% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 75.00% | 1.80% | 0.00% | 23.19% | NA |
| Indica II | 465 | 19.80% | 24.90% | 0.00% | 55.27% | NA |
| Indica III | 913 | 20.50% | 45.10% | 0.44% | 33.95% | NA |
| Indica Intermediate | 786 | 38.50% | 20.90% | 0.76% | 39.82% | NA |
| Temperate Japonica | 767 | 67.80% | 5.00% | 0.52% | 26.73% | NA |
| Tropical Japonica | 504 | 36.50% | 20.00% | 0.60% | 42.86% | NA |
| Japonica Intermediate | 241 | 65.60% | 23.70% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 60.00% | 12.20% | 0.00% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009640089 | C -> A | LOC_Os10g18930.1 | upstream_gene_variant ; 1643.0bp to feature; MODIFIER | silent_mutation | Average:31.365; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg1009640089 | C -> A | LOC_Os10g18940.1 | downstream_gene_variant ; 3682.0bp to feature; MODIFIER | silent_mutation | Average:31.365; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg1009640089 | C -> A | LOC_Os10g18930-LOC_Os10g18940 | intergenic_region ; MODIFIER | silent_mutation | Average:31.365; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg1009640089 | C -> DEL | N | N | silent_mutation | Average:31.365; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009640089 | NA | 1.60E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 5.71E-07 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 7.00E-07 | NA | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 2.60E-07 | NA | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 3.85E-11 | 3.76E-14 | mr1113 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 5.00E-06 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.29E-08 | 1.18E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.55E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.43E-07 | 1.47E-11 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 7.68E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.54E-06 | 5.11E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 7.75E-11 | 1.35E-21 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 3.71E-06 | 1.09E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.03E-06 | 1.32E-08 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 6.29E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 2.92E-08 | 4.01E-16 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 4.61E-07 | 1.73E-10 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 2.53E-08 | 1.60E-11 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 9.18E-09 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 6.83E-12 | 1.14E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 7.65E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 5.86E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.65E-08 | 1.37E-15 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 3.59E-07 | 1.07E-09 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 7.44E-07 | 4.33E-15 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.17E-06 | 8.77E-12 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 2.94E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 2.00E-06 | 3.07E-08 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 9.10E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.40E-10 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.92E-11 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.34E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 9.09E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 7.05E-09 | 4.10E-21 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 3.76E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.86E-11 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 8.03E-06 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 8.85E-06 | 2.80E-11 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.22E-09 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.92E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 3.88E-07 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 1.44E-08 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 8.77E-10 | 1.93E-24 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.47E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | 6.58E-06 | 1.46E-20 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 1.70E-12 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 9.66E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009640089 | NA | 5.95E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |