\
| Variant ID: vg1009637244 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9637244 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 82. )
TCGTCTGTGTTGATGTCGATTCTCCTTCACTTTATTGTCATTCTCTGCGAAAGGTTAGTAAACCTAATACTAGTGAAATATTATTATTCTAACATATCTA[C/T]
GCATTGCAAGCATCACTAGTTCTCCTTTATTTTGGTAATATTGACGGTCGAAACTGATCGATAACGACCGTCAACACAGGTGTTCAAATATTCAGCAATT
AATTGCTGAATATTTGAACACCTGTGTTGACGGTCGTTATCGATCAGTTTCGACCGTCAATATTACCAAAATAAAGGAGAACTAGTGATGCTTGCAATGC[G/A]
TAGATATGTTAGAATAATAATATTTCACTAGTATTAGGTTTACTAACCTTTCGCAGAGAATGACAATAAAGTGAAGGAGAATCGACATCAACACAGACGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.50% | 34.20% | 0.68% | 22.66% | NA |
| All Indica | 2759 | 56.70% | 6.00% | 1.05% | 36.21% | NA |
| All Japonica | 1512 | 23.70% | 72.70% | 0.07% | 3.57% | NA |
| Aus | 269 | 12.30% | 86.20% | 0.00% | 1.49% | NA |
| Indica I | 595 | 72.30% | 3.50% | 1.18% | 23.03% | NA |
| Indica II | 465 | 40.60% | 3.90% | 0.86% | 54.62% | NA |
| Indica III | 913 | 61.30% | 5.50% | 0.77% | 32.42% | NA |
| Indica Intermediate | 786 | 49.10% | 9.80% | 1.40% | 39.69% | NA |
| Temperate Japonica | 767 | 16.90% | 82.80% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 22.00% | 68.30% | 0.20% | 9.52% | NA |
| Japonica Intermediate | 241 | 48.50% | 49.80% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 20.80% | 77.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 34.40% | 50.00% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009637244 | C -> T | LOC_Os10g18920.1 | downstream_gene_variant ; 3828.0bp to feature; MODIFIER | silent_mutation | Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 | N | N | N | N |
| vg1009637244 | C -> T | LOC_Os10g18930.1 | downstream_gene_variant ; 288.0bp to feature; MODIFIER | silent_mutation | Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 | N | N | N | N |
| vg1009637244 | C -> T | LOC_Os10g18920-LOC_Os10g18930 | intergenic_region ; MODIFIER | silent_mutation | Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 | N | N | N | N |
| vg1009637244 | C -> DEL | N | N | silent_mutation | Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009637244 | NA | 5.09E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | 2.34E-07 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 1.82E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 3.58E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | 4.68E-06 | NA | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 4.15E-07 | mr1346 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | 1.66E-07 | 3.05E-08 | mr1405 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 1.30E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 7.44E-08 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 2.01E-07 | mr1792 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 6.90E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 8.50E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 1.50E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009637244 | NA | 1.04E-07 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |