\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009637244:

Variant ID: vg1009637244 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9637244
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCTGTGTTGATGTCGATTCTCCTTCACTTTATTGTCATTCTCTGCGAAAGGTTAGTAAACCTAATACTAGTGAAATATTATTATTCTAACATATCTA[C/T]
GCATTGCAAGCATCACTAGTTCTCCTTTATTTTGGTAATATTGACGGTCGAAACTGATCGATAACGACCGTCAACACAGGTGTTCAAATATTCAGCAATT

Reverse complement sequence

AATTGCTGAATATTTGAACACCTGTGTTGACGGTCGTTATCGATCAGTTTCGACCGTCAATATTACCAAAATAAAGGAGAACTAGTGATGCTTGCAATGC[G/A]
TAGATATGTTAGAATAATAATATTTCACTAGTATTAGGTTTACTAACCTTTCGCAGAGAATGACAATAAAGTGAAGGAGAATCGACATCAACACAGACGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 34.20% 0.68% 22.66% NA
All Indica  2759 56.70% 6.00% 1.05% 36.21% NA
All Japonica  1512 23.70% 72.70% 0.07% 3.57% NA
Aus  269 12.30% 86.20% 0.00% 1.49% NA
Indica I  595 72.30% 3.50% 1.18% 23.03% NA
Indica II  465 40.60% 3.90% 0.86% 54.62% NA
Indica III  913 61.30% 5.50% 0.77% 32.42% NA
Indica Intermediate  786 49.10% 9.80% 1.40% 39.69% NA
Temperate Japonica  767 16.90% 82.80% 0.00% 0.26% NA
Tropical Japonica  504 22.00% 68.30% 0.20% 9.52% NA
Japonica Intermediate  241 48.50% 49.80% 0.00% 1.66% NA
VI/Aromatic  96 20.80% 77.10% 1.04% 1.04% NA
Intermediate  90 34.40% 50.00% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009637244 C -> T LOC_Os10g18920.1 downstream_gene_variant ; 3828.0bp to feature; MODIFIER silent_mutation Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg1009637244 C -> T LOC_Os10g18930.1 downstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg1009637244 C -> T LOC_Os10g18920-LOC_Os10g18930 intergenic_region ; MODIFIER silent_mutation Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg1009637244 C -> DEL N N silent_mutation Average:30.786; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009637244 NA 5.09E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 2.34E-07 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 1.82E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 3.58E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 4.68E-06 NA mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 4.15E-07 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 1.66E-07 3.05E-08 mr1405 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 1.30E-06 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 7.44E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 2.01E-07 mr1792 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 6.90E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 8.50E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 1.50E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009637244 NA 1.04E-07 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251