Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009632737:

Variant ID: vg1009632737 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9632737
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATGGACTAACCACACCTCTAGAGTAATTATAATGTTGATATTACTAGTACAAAACTGCACCGGACATCCAAATCGACCAATCTGTGATGGAGTCGTG[C/T]
GGCCTGTTATAGAGATATTCATCTTTATCAGACCTCAAAGAACTCTATCACATAGGCACCGAGAGAGGCAGTATGTGAGTCCTCGGGGCCAGGCCCGTCC

Reverse complement sequence

GGACGGGCCTGGCCCCGAGGACTCACATACTGCCTCTCTCGGTGCCTATGTGATAGAGTTCTTTGAGGTCTGATAAAGATGAATATCTCTATAACAGGCC[G/A]
CACGACTCCATCACAGATTGGTCGATTTGGATGTCCGGTGCAGTTTTGTACTAGTAATATCAACATTATAATTACTCTAGAGGTGTGGTTAGTCCATTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	19.10%	0.72%	22.03%	NA
All Indica	2759	38.30%	25.40%	1.09%	35.23%	NA
All Japonica	1512	83.70%	12.70%	0.13%	3.44%	NA
Aus	269	98.50%	0.00%	0.37%	1.12%	NA
Indica I	595	74.80%	1.70%	0.67%	22.86%	NA
Indica II	465	20.40%	24.50%	1.51%	53.55%	NA
Indica III	913	22.20%	45.10%	1.10%	31.54%	NA
Indica Intermediate	786	39.80%	21.00%	1.15%	38.04%	NA
Temperate Japonica	767	95.00%	4.70%	0.00%	0.26%	NA
Tropical Japonica	504	70.60%	19.80%	0.40%	9.13%	NA
Japonica Intermediate	241	75.10%	23.20%	0.00%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	72.20%	12.20%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009632737	C -> T	LOC_Os10g18920.1	upstream_gene_variant ; 175.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1009632737	C -> T	LOC_Os10g18890.1	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1009632737	C -> T	LOC_Os10g18910.1	downstream_gene_variant ; 561.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1009632737	C -> T	LOC_Os10g18930.1	downstream_gene_variant ; 4795.0bp to feature; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1009632737	C -> T	LOC_Os10g18910-LOC_Os10g18920	intergenic_region ; MODIFIER	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1009632737	C -> DEL	N	N	silent_mutation	Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009632737	8.57E-06	2.63E-12	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.74E-06	NA	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	2.47E-09	2.74E-14	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	8.56E-07	NA	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	3.26E-10	3.60E-14	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	5.43E-07	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.14E-08	2.58E-13	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	5.78E-06	1.05E-07	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	2.50E-08	6.12E-19	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	6.52E-08	8.00E-12	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	5.30E-08	3.92E-10	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	8.80E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	5.29E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	6.65E-09	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	6.96E-10	1.69E-13	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.76E-07	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.15E-08	2.09E-22	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	3.53E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	1.65E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	3.70E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	9.99E-06	5.41E-14	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	2.14E-10	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	1.88E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	7.48E-08	6.76E-10	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	4.55E-08	1.50E-14	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	8.27E-10	1.16E-16	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.30E-08	2.50E-13	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.21E-06	4.70E-18	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	4.46E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	5.06E-07	6.98E-12	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	3.84E-09	1.07E-15	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	3.67E-07	NA	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.32E-06	1.03E-11	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	9.20E-08	1.04E-13	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.28E-07	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.44E-06	1.29E-08	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	1.25E-08	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	2.27E-08	2.77E-22	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	2.30E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	8.09E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	5.16E-07	6.96E-21	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	1.04E-13	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737	NA	3.46E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251