\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009632737:

Variant ID: vg1009632737 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9632737
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATGGACTAACCACACCTCTAGAGTAATTATAATGTTGATATTACTAGTACAAAACTGCACCGGACATCCAAATCGACCAATCTGTGATGGAGTCGTG[C/T]
GGCCTGTTATAGAGATATTCATCTTTATCAGACCTCAAAGAACTCTATCACATAGGCACCGAGAGAGGCAGTATGTGAGTCCTCGGGGCCAGGCCCGTCC

Reverse complement sequence

GGACGGGCCTGGCCCCGAGGACTCACATACTGCCTCTCTCGGTGCCTATGTGATAGAGTTCTTTGAGGTCTGATAAAGATGAATATCTCTATAACAGGCC[G/A]
CACGACTCCATCACAGATTGGTCGATTTGGATGTCCGGTGCAGTTTTGTACTAGTAATATCAACATTATAATTACTCTAGAGGTGTGGTTAGTCCATTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 19.10% 0.72% 22.03% NA
All Indica  2759 38.30% 25.40% 1.09% 35.23% NA
All Japonica  1512 83.70% 12.70% 0.13% 3.44% NA
Aus  269 98.50% 0.00% 0.37% 1.12% NA
Indica I  595 74.80% 1.70% 0.67% 22.86% NA
Indica II  465 20.40% 24.50% 1.51% 53.55% NA
Indica III  913 22.20% 45.10% 1.10% 31.54% NA
Indica Intermediate  786 39.80% 21.00% 1.15% 38.04% NA
Temperate Japonica  767 95.00% 4.70% 0.00% 0.26% NA
Tropical Japonica  504 70.60% 19.80% 0.40% 9.13% NA
Japonica Intermediate  241 75.10% 23.20% 0.00% 1.66% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 72.20% 12.20% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009632737 C -> T LOC_Os10g18920.1 upstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1009632737 C -> T LOC_Os10g18890.1 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1009632737 C -> T LOC_Os10g18910.1 downstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1009632737 C -> T LOC_Os10g18930.1 downstream_gene_variant ; 4795.0bp to feature; MODIFIER silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1009632737 C -> T LOC_Os10g18910-LOC_Os10g18920 intergenic_region ; MODIFIER silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1009632737 C -> DEL N N silent_mutation Average:64.298; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009632737 8.57E-06 2.63E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.74E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 2.47E-09 2.74E-14 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 8.56E-07 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 3.26E-10 3.60E-14 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 5.43E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.14E-08 2.58E-13 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 5.78E-06 1.05E-07 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 2.50E-08 6.12E-19 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 6.52E-08 8.00E-12 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 5.30E-08 3.92E-10 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 8.80E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 5.29E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 6.65E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 6.96E-10 1.69E-13 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.76E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.15E-08 2.09E-22 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 3.53E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 1.65E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 3.70E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 9.99E-06 5.41E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 2.14E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 1.88E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 7.48E-08 6.76E-10 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 4.55E-08 1.50E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 8.27E-10 1.16E-16 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.30E-08 2.50E-13 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.21E-06 4.70E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 4.46E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 5.06E-07 6.98E-12 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 3.84E-09 1.07E-15 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 3.67E-07 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.32E-06 1.03E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 9.20E-08 1.04E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.28E-07 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.44E-06 1.29E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 1.25E-08 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 2.27E-08 2.77E-22 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 2.30E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 8.09E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 5.16E-07 6.96E-21 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 1.04E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009632737 NA 3.46E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251