\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009620429:

Variant ID: vg1009620429 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9620429
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTACGTACGTATAAAAACCTAAAAAAAATACACGTATATAAATTTTATAAATGTGTATATAAACTTTGTATACATGTATAAAAAATTGGTATATGTAC[G/A]
TATAAAAACTAAAAAATACACGTATACAAAGTTTGTATTTGTACGTATATAAAGTTTGCATACATACATATTAAAAACAGAAAAAGATATGGAAAGAAAG

Reverse complement sequence

CTTTCTTTCCATATCTTTTTCTGTTTTTAATATGTATGTATGCAAACTTTATATACGTACAAATACAAACTTTGTATACGTGTATTTTTTAGTTTTTATA[C/T]
GTACATATACCAATTTTTTATACATGTATACAAAGTTTATATACACATTTATAAAATTTATATACGTGTATTTTTTTTAGGTTTTTATACGTACGTACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 19.80% 0.53% 0.00% NA
All Indica  2759 66.00% 33.10% 0.87% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 20.50% 77.00% 2.52% 0.00% NA
Indica II  465 83.90% 16.10% 0.00% 0.00% NA
Indica III  913 82.90% 16.80% 0.33% 0.00% NA
Indica Intermediate  786 70.20% 29.00% 0.76% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009620429 G -> A LOC_Os10g18880.1 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:32.715; most accessible tissue: Callus, score: 81.944 N N N N
vg1009620429 G -> A LOC_Os10g18890.1 upstream_gene_variant ; 4278.0bp to feature; MODIFIER silent_mutation Average:32.715; most accessible tissue: Callus, score: 81.944 N N N N
vg1009620429 G -> A LOC_Os10g18870.1 downstream_gene_variant ; 2249.0bp to feature; MODIFIER silent_mutation Average:32.715; most accessible tissue: Callus, score: 81.944 N N N N
vg1009620429 G -> A LOC_Os10g18870-LOC_Os10g18880 intergenic_region ; MODIFIER silent_mutation Average:32.715; most accessible tissue: Callus, score: 81.944 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009620429 6.48E-07 1.16E-39 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 1.21E-06 3.72E-20 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.50E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.28E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.77E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 2.94E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 1.65E-07 4.76E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 6.54E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 1.54E-06 1.37E-36 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 2.53E-06 2.74E-18 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 4.80E-06 6.75E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 1.40E-07 4.55E-28 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.44E-09 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 6.31E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.02E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 8.82E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 7.11E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.26E-19 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.54E-23 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 2.75E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.79E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 3.73E-08 3.44E-40 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 9.37E-07 1.13E-20 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 8.75E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.61E-30 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.24E-27 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.29E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.91E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 4.71E-09 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 6.32E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.16E-15 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 3.60E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 1.17E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009620429 NA 2.22E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251