\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009602228:

Variant ID: vg1009602228 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9602228
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.18, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCCCTATATATAACAGTCGATTTTCACATCATTTCGTCTGTGATACGGTGGGCCTATGGTAATCTTGAGACCTGCTGAAGAAAGGAAGCTGATGCTA[T/C]
TGCTAATCGTGGAATAACGTCGATGAAGCCGAACAATCTGATGAGGCCGTCATCCTAGTAACAATCTTTTTTCTGCTTCGTCTATAAAGCTCACAATAAA

Reverse complement sequence

TTTATTGTGAGCTTTATAGACGAAGCAGAAAAAAGATTGTTACTAGGATGACGGCCTCATCAGATTGTTCGGCTTCATCGACGTTATTCCACGATTAGCA[A/G]
TAGCATCAGCTTCCTTTCTTCAGCAGGTCTCAAGATTACCATAGGCCCACCGTATCACAGACGAAATGATGTGAAAATCGACTGTTATATATAGGGCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.90% 0.11% 0.00% NA
All Indica  2759 94.60% 5.30% 0.07% 0.00% NA
All Japonica  1512 17.70% 82.30% 0.00% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 91.20% 8.80% 0.00% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 31.20% 68.80% 0.00% 0.00% NA
Japonica Intermediate  241 27.80% 72.20% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 43.30% 54.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009602228 T -> C LOC_Os10g18850.1 downstream_gene_variant ; 4984.0bp to feature; MODIFIER silent_mutation Average:50.173; most accessible tissue: Callus, score: 92.237 N N N N
vg1009602228 T -> C LOC_Os10g18840-LOC_Os10g18850 intergenic_region ; MODIFIER silent_mutation Average:50.173; most accessible tissue: Callus, score: 92.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009602228 NA 9.11E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.76E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 7.47E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 9.10E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 9.40E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 5.64E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 6.96E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.77E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 2.28E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 4.64E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.16E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 2.24E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.41E-58 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 4.89E-19 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.02E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.47E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.09E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 7.10E-29 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 6.58E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 2.39E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 8.91E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 1.08E-18 mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009602228 NA 8.08E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251