Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009567423:

Variant ID: vg1009567423 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9567423
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCCCGGTTGTTTATACCAACCGGGACTAAAAAAGAATTGGGGTCTAACTCGGTCTGATAACTTTTTGAACCGGGACTAAAAATGATCTTTAGTCCC[G/A]
GTTCCTATTCGAACCGGGACTATTGTGGATTTTGGGCGACCGAGCAAAGATGGTTTCTCCACCAGTGACACCAGAAAATGGCGAGTGGGCCATTGTTGGT

Reverse complement sequence

ACCAACAATGGCCCACTCGCCATTTTCTGGTGTCACTGGTGGAGAAACCATCTTTGCTCGGTCGCCCAAAATCCACAATAGTCCCGGTTCGAATAGGAAC[C/T]
GGGACTAAAGATCATTTTTAGTCCCGGTTCAAAAAGTTATCAGACCGAGTTAGACCCCAATTCTTTTTTAGTCCCGGTTGGTATAAACAACCGGGACTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	13.90%	9.33%	6.07%	NA
All Indica	2759	76.50%	17.10%	6.02%	0.36%	NA
All Japonica	1512	52.90%	12.00%	17.13%	17.92%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.30%	0.17%	0.34%	NA
Indica II	465	78.70%	15.90%	5.38%	0.00%	NA
Indica III	913	58.30%	29.80%	11.06%	0.88%	NA
Indica Intermediate	786	80.20%	14.90%	4.96%	0.00%	NA
Temperate Japonica	767	59.70%	4.70%	23.73%	11.86%	NA
Tropical Japonica	504	44.60%	18.30%	9.33%	27.78%	NA
Japonica Intermediate	241	48.50%	22.40%	12.45%	16.60%	NA
VI/Aromatic	96	88.50%	0.00%	10.42%	1.04%	NA
Intermediate	90	81.10%	6.70%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009567423	G -> A	LOC_Os10g18790.1	upstream_gene_variant ; 2795.0bp to feature; MODIFIER	silent_mutation	Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1009567423	G -> A	LOC_Os10g18800.1	upstream_gene_variant ; 50.0bp to feature; MODIFIER	silent_mutation	Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1009567423	G -> A	LOC_Os10g18790-LOC_Os10g18800	intergenic_region ; MODIFIER	silent_mutation	Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1009567423	G -> DEL	N	N	silent_mutation	Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009567423	NA	2.83E-07	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	6.32E-07	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	4.38E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	2.49E-07	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	1.63E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	1.62E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	7.06E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	6.19E-08	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	1.06E-14	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	4.91E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	1.25E-06	NA	mr1619	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	4.11E-07	4.35E-09	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	5.07E-11	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	1.51E-07	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	5.22E-08	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	7.67E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	2.88E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	4.76E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	3.21E-16	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	4.68E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	1.89E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	5.60E-06	2.26E-17	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	3.69E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	2.81E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	2.44E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423	NA	2.61E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251