\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009567423:

Variant ID: vg1009567423 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9567423
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCCCGGTTGTTTATACCAACCGGGACTAAAAAAGAATTGGGGTCTAACTCGGTCTGATAACTTTTTGAACCGGGACTAAAAATGATCTTTAGTCCC[G/A]
GTTCCTATTCGAACCGGGACTATTGTGGATTTTGGGCGACCGAGCAAAGATGGTTTCTCCACCAGTGACACCAGAAAATGGCGAGTGGGCCATTGTTGGT

Reverse complement sequence

ACCAACAATGGCCCACTCGCCATTTTCTGGTGTCACTGGTGGAGAAACCATCTTTGCTCGGTCGCCCAAAATCCACAATAGTCCCGGTTCGAATAGGAAC[C/T]
GGGACTAAAGATCATTTTTAGTCCCGGTTCAAAAAGTTATCAGACCGAGTTAGACCCCAATTCTTTTTTAGTCCCGGTTGGTATAAACAACCGGGACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 13.90% 9.33% 6.07% NA
All Indica  2759 76.50% 17.10% 6.02% 0.36% NA
All Japonica  1512 52.90% 12.00% 17.13% 17.92% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.30% 0.17% 0.34% NA
Indica II  465 78.70% 15.90% 5.38% 0.00% NA
Indica III  913 58.30% 29.80% 11.06% 0.88% NA
Indica Intermediate  786 80.20% 14.90% 4.96% 0.00% NA
Temperate Japonica  767 59.70% 4.70% 23.73% 11.86% NA
Tropical Japonica  504 44.60% 18.30% 9.33% 27.78% NA
Japonica Intermediate  241 48.50% 22.40% 12.45% 16.60% NA
VI/Aromatic  96 88.50% 0.00% 10.42% 1.04% NA
Intermediate  90 81.10% 6.70% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009567423 G -> A LOC_Os10g18790.1 upstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1009567423 G -> A LOC_Os10g18800.1 upstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1009567423 G -> A LOC_Os10g18790-LOC_Os10g18800 intergenic_region ; MODIFIER silent_mutation Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1009567423 G -> DEL N N silent_mutation Average:44.943; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009567423 NA 2.83E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 6.32E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 4.38E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 2.49E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 1.63E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 1.62E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 7.06E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 6.19E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 1.06E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 4.91E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 1.25E-06 NA mr1619 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 4.11E-07 4.35E-09 mr1619 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 5.07E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 1.51E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 5.22E-08 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 7.67E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 2.88E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 4.76E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 3.21E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 4.68E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 1.89E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 5.60E-06 2.26E-17 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 3.69E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 2.81E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 2.44E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009567423 NA 2.61E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251