\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009559420:

Variant ID: vg1009559420 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9559420
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGGTACAATAGCAGGCTATAAGCCAGCTGCAAATATATTTTAAGGGGATAAATAAGAAGAGAGAAGAGCAGTAGGCTACAGATTTGTAGCCAGTTGTA[G/A,T]
CACGGACTTCAAGACGCAGTGTGTGTATGACATGTGAGACTAGGTATTAATAGTGTAGTATATAACTATTGTATGGACGAGCTATTAGATTGGCTATAAA

Reverse complement sequence

TTTATAGCCAATCTAATAGCTCGTCCATACAATAGTTATATACTACACTATTAATACCTAGTCTCACATGTCATACACACACTGCGTCTTGAAGTCCGTG[C/T,A]
TACAACTGGCTACAAATCTGTAGCCTACTGCTCTTCTCTCTTCTTATTTATCCCCTTAAAATATATTTGCAGCTGGCTTATAGCCTGCTATTGTACCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.10% 0.17% 0.00% T: 0.04%
All Indica  2759 57.00% 42.80% 0.25% 0.00% NA
All Japonica  1512 87.30% 12.50% 0.07% 0.00% T: 0.13%
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 72.80% 27.20% 0.00% 0.00% NA
Indica II  465 40.00% 59.80% 0.22% 0.00% NA
Indica III  913 61.70% 38.00% 0.33% 0.00% NA
Indica Intermediate  786 49.60% 50.00% 0.38% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 67.30% 32.10% 0.20% 0.00% T: 0.40%
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009559420 G -> T LOC_Os10g18790.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:72.88; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1009559420 G -> T LOC_Os10g18780-LOC_Os10g18790 intergenic_region ; MODIFIER silent_mutation Average:72.88; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1009559420 G -> A LOC_Os10g18790.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:72.88; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1009559420 G -> A LOC_Os10g18780-LOC_Os10g18790 intergenic_region ; MODIFIER silent_mutation Average:72.88; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009559420 3.20E-06 NA mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 2.46E-07 1.61E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 5.33E-07 NA mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 5.97E-06 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 4.04E-07 8.37E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 1.22E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 1.10E-07 2.07E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 5.35E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 3.74E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 1.27E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 1.24E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 1.43E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 8.62E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 3.02E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 2.47E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 3.59E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 7.72E-06 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 5.19E-06 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 2.79E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 2.37E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 4.16E-14 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009559420 NA 1.62E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251