Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1009530059:

Variant ID: vg1009530059 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9530059
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCGAATGGTTCATCGGCGTATCCCACCTTGGATAGATCTACTAAAGTGAAACCTTCCTTGTCGACTTTGAGACCAGTGCGTATATTCACCCAATGGCA[G/T,A]
CGAAACAAAGGAACCTTGAACTTGACGTAGTTTAGCTCCCAGATCTCCTCAATGCGGCCGTAGTATGTGTTTGACCCAACTTGATCCTGGAATGCATCTA

Reverse complement sequence

TAGATGCATTCCAGGATCAAGTTGGGTCAAACACATACTACGGCCGCATTGAGGAGATCTGGGAGCTAAACTACGTCAAGTTCAAGGTTCCTTTGTTTCG[C/A,T]
TGCCATTGGGTGAATATACGCACTGGTCTCAAAGTCGACAAGGAAGGTTTCACTTTAGTAGATCTATCCAAGGTGGGATACGCCGATGAACCATTCGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 27.80% 0.44% 4.46% NA
All Indica  2759 70.80% 26.70% 0.72% 1.78% NA
All Japonica  1512 60.60% 29.40% 0.07% 9.92% NA
Aus  269 63.60% 36.40% 0.00% 0.00% NA
Indica I  595 91.30% 3.20% 2.35% 3.19% NA
Indica II  465 76.10% 22.80% 0.00% 1.08% NA
Indica III  913 53.00% 45.50% 0.44% 1.10% NA
Indica Intermediate  786 72.90% 24.90% 0.25% 1.91% NA
Temperate Japonica  767 69.20% 18.90% 0.13% 11.73% NA
Tropical Japonica  504 54.20% 44.40% 0.00% 1.39% NA
Japonica Intermediate  241 46.90% 31.10% 0.00% 21.99% NA
VI/Aromatic  96 67.70% 21.90% 0.00% 10.42% NA
Intermediate  90 80.00% 17.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009530059 G -> T LOC_Os10g18740.1 synonymous_variant ; p.Arg528Arg; LOW N Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1009530059 G -> T LOC_Os10g18750.1 downstream_gene_variant ; 4457.0bp to feature; MODIFIER N Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1009530059 G -> A LOC_Os10g18740.1 synonymous_variant ; p.Arg528Arg; LOW synonymous_codon Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1009530059 G -> A LOC_Os10g18740.1 synonymous_variant ; p.Arg528Arg; LOW nonsynonymous_codon ; R528P Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964 possibly damaging 1.855 DELETERIOUS 0.01
vg1009530059 G -> DEL LOC_Os10g18740.1 N frameshift_variant Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009530059 NA 1.57E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009530059 5.47E-06 1.10E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 9.03E-08 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.56E-06 3.56E-06 mr1110 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.81E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.38E-07 1.74E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 7.75E-08 6.76E-12 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 5.74E-11 5.07E-28 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 2.17E-14 2.98E-25 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 2.04E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 8.62E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 3.65E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 6.04E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 5.24E-06 2.37E-14 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.41E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.92E-07 7.77E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.54E-09 2.72E-29 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 5.54E-12 5.94E-27 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 3.44E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.07E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 4.71E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.38E-08 1.33E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.15E-07 2.15E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.08E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 6.61E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 2.13E-06 1.28E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.09E-06 1.95E-13 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.53E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 2.77E-07 5.37E-26 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 2.28E-11 9.62E-26 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 2.39E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 2.91E-10 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.32E-07 2.59E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 7.11E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 6.82E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.47E-08 5.08E-15 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.69E-06 4.35E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.50E-07 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 8.72E-09 2.05E-10 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 3.66E-08 1.05E-31 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.37E-10 5.31E-27 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 7.06E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 5.26E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.69E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 1.53E-06 NA mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 2.54E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.93E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 3.37E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 1.11E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059 NA 2.77E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251