Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009530059:

Variant ID: vg1009530059 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9530059
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCGAATGGTTCATCGGCGTATCCCACCTTGGATAGATCTACTAAAGTGAAACCTTCCTTGTCGACTTTGAGACCAGTGCGTATATTCACCCAATGGCA[G/T,A]
CGAAACAAAGGAACCTTGAACTTGACGTAGTTTAGCTCCCAGATCTCCTCAATGCGGCCGTAGTATGTGTTTGACCCAACTTGATCCTGGAATGCATCTA

Reverse complement sequence

TAGATGCATTCCAGGATCAAGTTGGGTCAAACACATACTACGGCCGCATTGAGGAGATCTGGGAGCTAAACTACGTCAAGTTCAAGGTTCCTTTGTTTCG[C/A,T]
TGCCATTGGGTGAATATACGCACTGGTCTCAAAGTCGACAAGGAAGGTTTCACTTTAGTAGATCTATCCAAGGTGGGATACGCCGATGAACCATTCGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	27.80%	0.44%	4.46%	NA
All Indica	2759	70.80%	26.70%	0.72%	1.78%	NA
All Japonica	1512	60.60%	29.40%	0.07%	9.92%	NA
Aus	269	63.60%	36.40%	0.00%	0.00%	NA
Indica I	595	91.30%	3.20%	2.35%	3.19%	NA
Indica II	465	76.10%	22.80%	0.00%	1.08%	NA
Indica III	913	53.00%	45.50%	0.44%	1.10%	NA
Indica Intermediate	786	72.90%	24.90%	0.25%	1.91%	NA
Temperate Japonica	767	69.20%	18.90%	0.13%	11.73%	NA
Tropical Japonica	504	54.20%	44.40%	0.00%	1.39%	NA
Japonica Intermediate	241	46.90%	31.10%	0.00%	21.99%	NA
VI/Aromatic	96	67.70%	21.90%	0.00%	10.42%	NA
Intermediate	90	80.00%	17.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009530059	G -> T	LOC_Os10g18740.1	synonymous_variant ; p.Arg528Arg; LOW	N	Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg1009530059	G -> T	LOC_Os10g18750.1	downstream_gene_variant ; 4457.0bp to feature; MODIFIER	N	Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg1009530059	G -> A	LOC_Os10g18740.1	synonymous_variant ; p.Arg528Arg; LOW	synonymous_codon	Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg1009530059	G -> A	LOC_Os10g18740.1	synonymous_variant ; p.Arg528Arg; LOW	nonsynonymous_codon ; R528P	Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964	possibly damaging	1.855	DELETERIOUS	0.01
vg1009530059	G -> DEL	LOC_Os10g18740.1	N	frameshift_variant	Average:39.834; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009530059	NA	1.57E-07	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009530059	5.47E-06	1.10E-14	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	9.03E-08	NA	mr1110	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.56E-06	3.56E-06	mr1110	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.81E-10	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.38E-07	1.74E-11	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	7.75E-08	6.76E-12	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	5.74E-11	5.07E-28	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	2.17E-14	2.98E-25	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	2.04E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	8.62E-09	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	3.65E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	6.04E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	5.24E-06	2.37E-14	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.41E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.92E-07	7.77E-11	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.54E-09	2.72E-29	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	5.54E-12	5.94E-27	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	3.44E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.07E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	4.71E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.38E-08	1.33E-12	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.15E-07	2.15E-12	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.08E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	6.61E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	2.13E-06	1.28E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.09E-06	1.95E-13	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.53E-10	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	2.77E-07	5.37E-26	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	2.28E-11	9.62E-26	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	2.39E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	2.91E-10	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.32E-07	2.59E-14	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	7.11E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	6.82E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.47E-08	5.08E-15	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.69E-06	4.35E-13	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.50E-07	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	8.72E-09	2.05E-10	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	3.66E-08	1.05E-31	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.37E-10	5.31E-27	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	7.06E-10	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	5.26E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.69E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	1.53E-06	NA	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	2.54E-14	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.93E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	3.37E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	1.11E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009530059	NA	2.77E-07	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251