Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009516560:

Variant ID: vg1009516560 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9516560
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCTCCGTGCAGCTGCTGCTGGCTGCCCTCATCGCCTCCTCGCCAGTTCCGGTCGTCGTCCTCTCGTCGTTCCCGGTCGTCGTGGCGTTCGTCCCTCC[G/A]
TCAAGCCATTCTCGTCCGTCGTCCGCGTCCGTCAAGTGTGCCGCTGCAGCCCCGTCGTCGTCTTCGTCCTCGCCTCCGCGTCGTTAAGCCTTGTGCCAGC

Reverse complement sequence

GCTGGCACAAGGCTTAACGACGCGGAGGCGAGGACGAAGACGACGACGGGGCTGCAGCGGCACACTTGACGGACGCGGACGACGGACGAGAATGGCTTGA[C/T]
GGAGGGACGAACGCCACGACGACCGGGAACGACGAGAGGACGACGACCGGAACTGGCGAGGAGGCGATGAGGGCAGCCAGCAGCAGCTGCACGGAGACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	25.30%	18.28%	4.10%	NA
All Indica	2759	36.30%	35.10%	28.16%	0.43%	NA
All Japonica	1512	85.10%	2.20%	3.90%	8.73%	NA
Aus	269	40.90%	57.20%	1.86%	0.00%	NA
Indica I	595	7.70%	63.50%	28.74%	0.00%	NA
Indica II	465	38.50%	22.40%	38.92%	0.22%	NA
Indica III	913	55.20%	24.40%	19.28%	1.10%	NA
Indica Intermediate	786	34.60%	33.60%	31.68%	0.13%	NA
Temperate Japonica	767	87.90%	1.20%	0.65%	10.30%	NA
Tropical Japonica	504	85.90%	4.00%	9.13%	0.99%	NA
Japonica Intermediate	241	74.70%	2.10%	3.32%	19.92%	NA
VI/Aromatic	96	27.10%	19.80%	8.33%	44.79%	NA
Intermediate	90	54.40%	21.10%	16.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009516560	G -> A	LOC_Os10g18710.1	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg1009516560	G -> A	LOC_Os10g18720.1	upstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg1009516560	G -> A	LOC_Os10g18730.1	upstream_gene_variant ; 3100.0bp to feature; MODIFIER	silent_mutation	Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg1009516560	G -> A	LOC_Os10g18720-LOC_Os10g18730	intergenic_region ; MODIFIER	silent_mutation	Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg1009516560	G -> DEL	N	N	silent_mutation	Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009516560	NA	1.06E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	2.74E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	9.69E-09	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	2.78E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	6.43E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	4.30E-06	3.92E-09	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	1.94E-06	3.29E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	2.38E-06	1.38E-06	mr1092_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	1.76E-07	NA	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	5.91E-08	3.03E-07	mr1128_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	9.67E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	9.75E-06	8.74E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	3.39E-06	2.36E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	1.19E-06	1.92E-08	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	8.04E-07	8.04E-07	mr1250_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	3.31E-08	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560	NA	4.82E-08	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251