\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009516560:

Variant ID: vg1009516560 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9516560
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTCTCCGTGCAGCTGCTGCTGGCTGCCCTCATCGCCTCCTCGCCAGTTCCGGTCGTCGTCCTCTCGTCGTTCCCGGTCGTCGTGGCGTTCGTCCCTCC[G/A]
TCAAGCCATTCTCGTCCGTCGTCCGCGTCCGTCAAGTGTGCCGCTGCAGCCCCGTCGTCGTCTTCGTCCTCGCCTCCGCGTCGTTAAGCCTTGTGCCAGC

Reverse complement sequence

GCTGGCACAAGGCTTAACGACGCGGAGGCGAGGACGAAGACGACGACGGGGCTGCAGCGGCACACTTGACGGACGCGGACGACGGACGAGAATGGCTTGA[C/T]
GGAGGGACGAACGCCACGACGACCGGGAACGACGAGAGGACGACGACCGGAACTGGCGAGGAGGCGATGAGGGCAGCCAGCAGCAGCTGCACGGAGACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 25.30% 18.28% 4.10% NA
All Indica  2759 36.30% 35.10% 28.16% 0.43% NA
All Japonica  1512 85.10% 2.20% 3.90% 8.73% NA
Aus  269 40.90% 57.20% 1.86% 0.00% NA
Indica I  595 7.70% 63.50% 28.74% 0.00% NA
Indica II  465 38.50% 22.40% 38.92% 0.22% NA
Indica III  913 55.20% 24.40% 19.28% 1.10% NA
Indica Intermediate  786 34.60% 33.60% 31.68% 0.13% NA
Temperate Japonica  767 87.90% 1.20% 0.65% 10.30% NA
Tropical Japonica  504 85.90% 4.00% 9.13% 0.99% NA
Japonica Intermediate  241 74.70% 2.10% 3.32% 19.92% NA
VI/Aromatic  96 27.10% 19.80% 8.33% 44.79% NA
Intermediate  90 54.40% 21.10% 16.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009516560 G -> A LOC_Os10g18710.1 upstream_gene_variant ; 2855.0bp to feature; MODIFIER silent_mutation Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg1009516560 G -> A LOC_Os10g18720.1 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg1009516560 G -> A LOC_Os10g18730.1 upstream_gene_variant ; 3100.0bp to feature; MODIFIER silent_mutation Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg1009516560 G -> A LOC_Os10g18720-LOC_Os10g18730 intergenic_region ; MODIFIER silent_mutation Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg1009516560 G -> DEL N N silent_mutation Average:55.222; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009516560 NA 1.06E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 2.74E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 9.69E-09 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 2.78E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 6.43E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 4.30E-06 3.92E-09 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 1.94E-06 3.29E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 2.38E-06 1.38E-06 mr1092_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 1.76E-07 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 5.91E-08 3.03E-07 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 9.67E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 9.75E-06 8.74E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 3.39E-06 2.36E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 1.19E-06 1.92E-08 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 8.04E-07 8.04E-07 mr1250_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 3.31E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009516560 NA 4.82E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251